Incidental Mutation 'RF040:Gykl1'
Institutional Source Beutler Lab
Gene Symbol Gykl1
Ensembl Gene ENSMUSG00000053624
Gene Nameglycerol kinase-like 1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #RF040 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location52693679-52695668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52694416 bp
Amino Acid Change Arginine to Glutamine at position 232 (R232Q)
Ref Sequence ENSEMBL: ENSMUSP00000067598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066193]
Predicted Effect probably benign
Transcript: ENSMUST00000066193
AA Change: R232Q

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000067598
Gene: ENSMUSG00000053624
AA Change: R232Q

Pfam:FGGY_N 12 266 6.8e-90 PFAM
Pfam:FGGY_C 275 467 4.2e-66 PFAM
transmembrane domain 524 546 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the FGGY kinase family. This protein is a key enzyme in the regulation of glycerol uptake and metabolism. It catalyzes the phosphorylation of glycerol by ATP, yielding ADP and glycerol-3-phosphate. Mutations in this gene are associated with glycerol kinase deficiency (GKD). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik TG TGTCAGGGCAGCAGCAG 8: 84,167,575 probably benign Het
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,913,577 probably benign Het
A030005L19Rik G GTGGCTGCTC 1: 82,913,590 probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,618,971 probably null Het
Calhm1 C CTGTGGCTGTGGA 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dnajc2 TAGTTG T 5: 21,757,697 probably null Het
Fam71e1 C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,500,521 probably null Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Heatr3 TAT TATTGAT 8: 88,156,457 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Luzp1 A AGGTGGCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 AACA AACAACA X: 71,118,814 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l AGC AGCCGC 3: 59,275,967 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,081,363 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Olfr625-ps1 ACTTGCTGATATCTT ACTT 7: 103,682,938 probably null Het
Osmr TTCT TTCTTCT 15: 6,837,701 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l AC ACCACCGC 4: 134,279,515 probably benign Het
Rpgrip1 AGGAAGAGG AG 14: 52,149,537 probably null Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Smarca2 GC GCCCCACC 19: 26,631,022 probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,317,564 probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 probably benign Het
Tcof1 CT CTATT 18: 60,828,408 probably benign Het
Tfeb GCA GCAACA 17: 47,786,097 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,110 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCATCA 17: 47,786,112 probably benign Het
Tgoln1 T TCACCTCCCGTGGTCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tmem59 TTTGTTT TTTGTTTGGTTGTTT 4: 107,190,526 probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,967,063 probably benign Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 108,956,101 probably benign Het
Other mutations in Gykl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Gykl1 APN 18 52694736 missense possibly damaging 0.94
IGL02694:Gykl1 APN 18 52694185 missense probably benign 0.00
R0689:Gykl1 UTSW 18 52694051 missense possibly damaging 0.90
R0856:Gykl1 UTSW 18 52695369 makesense probably null
R0908:Gykl1 UTSW 18 52695369 makesense probably null
R1428:Gykl1 UTSW 18 52694761 missense probably benign 0.00
R2229:Gykl1 UTSW 18 52695267 missense probably benign 0.00
R5307:Gykl1 UTSW 18 52694651 missense possibly damaging 0.67
R5696:Gykl1 UTSW 18 52694195 missense probably benign 0.02
R6278:Gykl1 UTSW 18 52695208 missense probably benign 0.06
R8804:Gykl1 UTSW 18 52694536 missense probably benign 0.00
RF041:Gykl1 UTSW 18 52694416 missense probably benign 0.06
RF042:Gykl1 UTSW 18 52694416 missense probably benign 0.06
RF044:Gykl1 UTSW 18 52694416 missense probably benign 0.06
Z1088:Gykl1 UTSW 18 52694165 nonsense probably null
Z1176:Gykl1 UTSW 18 52694547 missense probably damaging 1.00
Z1177:Gykl1 UTSW 18 52695132 missense possibly damaging 0.81
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04