Incidental Mutation 'RF040:Cdx1'
Institutional Source Beutler Lab
Gene Symbol Cdx1
Ensembl Gene ENSMUSG00000024619
Gene Namecaudal type homeobox 1
SynonymsCdx-1, Cdx
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #RF040 (G1)
Quality Score217.468
Status Not validated
Chromosomal Location61018862-61036199 bp(-) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) CTGCTG to CTGCTGATGCTG at 61019870 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025521]
Predicted Effect probably benign
Transcript: ENSMUST00000025521
SMART Domains Protein: ENSMUSP00000025521
Gene: ENSMUSG00000024619

Pfam:Caudal_act 13 146 4.8e-31 PFAM
HOX 154 216 1.3e-25 SMART
low complexity region 217 246 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the caudal-related homeobox transcription factor gene family. The encoded DNA-binding protein regulates intestine-specific gene expression and enterocyte differentiation. It has been shown to induce expression of the intestinal alkaline phosphatase gene, and inhibit beta-catenin/T-cell factor transcriptional activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in abnormalities of the basiocciptal bone, vertebrae, and ribs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik TG TGTCAGGGCAGCAGCAG 8: 84,167,575 probably benign Het
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,913,577 probably benign Het
A030005L19Rik G GTGGCTGCTC 1: 82,913,590 probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,618,971 probably null Het
Calhm1 C CTGTGGCTGTGGA 19: 47,141,277 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dnajc2 TAGTTG T 5: 21,757,697 probably null Het
Fam71e1 C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,500,521 probably null Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Heatr3 TAT TATTGAT 8: 88,156,457 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Luzp1 A AGGTGGCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 AACA AACAACA X: 71,118,814 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l AGC AGCCGC 3: 59,275,967 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,081,363 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Olfr625-ps1 ACTTGCTGATATCTT ACTT 7: 103,682,938 probably null Het
Osmr TTCT TTCTTCT 15: 6,837,701 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l AC ACCACCGC 4: 134,279,515 probably benign Het
Rpgrip1 AGGAAGAGG AG 14: 52,149,537 probably null Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Smarca2 GC GCCCCACC 19: 26,631,022 probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,317,564 probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 probably benign Het
Tcof1 CT CTATT 18: 60,828,408 probably benign Het
Tfeb GCA GCAACA 17: 47,786,097 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,110 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCATCA 17: 47,786,112 probably benign Het
Tgoln1 T TCACCTCCCGTGGTCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tmem59 TTTGTTT TTTGTTTGGTTGTTT 4: 107,190,526 probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,967,063 probably benign Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 108,956,101 probably benign Het
Other mutations in Cdx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
E0370:Cdx1 UTSW 18 61020429 missense probably damaging 1.00
FR4449:Cdx1 UTSW 18 61019881 small insertion probably benign
FR4737:Cdx1 UTSW 18 61019874 small insertion probably benign
FR4737:Cdx1 UTSW 18 61019878 small insertion probably benign
FR4976:Cdx1 UTSW 18 61019867 small insertion probably benign
FR4976:Cdx1 UTSW 18 61019869 small insertion probably benign
R0218:Cdx1 UTSW 18 61020364 splice site probably benign
R0481:Cdx1 UTSW 18 61020492 missense probably damaging 1.00
R1776:Cdx1 UTSW 18 61036014 missense probably benign 0.01
R1914:Cdx1 UTSW 18 61019898 missense probably benign 0.01
R1915:Cdx1 UTSW 18 61019898 missense probably benign 0.01
R2094:Cdx1 UTSW 18 61035912 missense possibly damaging 0.85
R4191:Cdx1 UTSW 18 61020438 missense possibly damaging 0.88
R5671:Cdx1 UTSW 18 61019899 missense probably benign 0.01
R8145:Cdx1 UTSW 18 61019923 missense probably damaging 1.00
RF036:Cdx1 UTSW 18 61019870 small insertion probably benign
RF038:Cdx1 UTSW 18 61019870 small insertion probably benign
RF039:Cdx1 UTSW 18 61019870 small insertion probably benign
RF049:Cdx1 UTSW 18 61019866 small insertion probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04