Incidental Mutation 'RF040:Smarca2'
ID604794
Institutional Source Beutler Lab
Gene Symbol Smarca2
Ensembl Gene ENSMUSG00000024921
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
SynonymsSnf2l2, brm, 2610209L14Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF040 (G1)
Quality Score216.468
Status Not validated
Chromosome19
Chromosomal Location26605050-26778322 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GC to GCCCCACC at 26631022 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025862] [ENSMUST00000099537] [ENSMUST00000176030] [ENSMUST00000176584] [ENSMUST00000176769] [ENSMUST00000208163]
Predicted Effect probably benign
Transcript: ENSMUST00000025862
SMART Domains Protein: ENSMUSP00000025862
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1501 3.13e-41 SMART
low complexity region 1502 1524 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1564 1576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099537
SMART Domains Protein: ENSMUSP00000097135
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 7e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
PDB:2DAT|A 1389 1410 1e-6 PDB
low complexity region 1480 1508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176030
SMART Domains Protein: ENSMUSP00000135784
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1519 1.74e-39 SMART
low complexity region 1520 1542 N/A INTRINSIC
low complexity region 1544 1558 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176584
SMART Domains Protein: ENSMUSP00000135344
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
QLQ 96 132 2.58e-13 SMART
low complexity region 140 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176769
SMART Domains Protein: ENSMUSP00000135017
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 908 4.18e-24 SMART
low complexity region 947 956 N/A INTRINSIC
HELICc 1033 1117 3.84e-23 SMART
low complexity region 1175 1190 N/A INTRINSIC
SnAC 1211 1279 7.29e-28 SMART
low complexity region 1286 1308 N/A INTRINSIC
BROMO 1333 1443 3.13e-41 SMART
low complexity region 1444 1466 N/A INTRINSIC
low complexity region 1468 1482 N/A INTRINSIC
low complexity region 1506 1518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208163
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene may exhibit infertility and a slightly increased body weight in some genetic backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik TG TGTCAGGGCAGCAGCAG 8: 84,167,575 probably benign Het
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,913,577 probably benign Het
A030005L19Rik G GTGGCTGCTC 1: 82,913,590 probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,618,971 probably null Het
Calhm1 C CTGTGGCTGTGGA 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dnajc2 TAGTTG T 5: 21,757,697 probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam71e1 C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,500,521 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Flywch1 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAGTCCTGGTGT 17: 23,762,169 probably null Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Heatr3 TAT TATTGAT 8: 88,156,457 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Luzp1 A AGGTGGCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 AACA AACAACA X: 71,118,814 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l AGC AGCCGC 3: 59,275,967 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,081,363 probably benign Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Olfr625-ps1 ACTTGCTGATATCTT ACTT 7: 103,682,938 probably null Het
Osmr TTCT TTCTTCT 15: 6,837,701 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l AC ACCACCGC 4: 134,279,515 probably benign Het
Rpgrip1 AGGAAGAGG AG 14: 52,149,537 probably null Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,317,564 probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 probably benign Het
Tcof1 CT CTATT 18: 60,828,408 probably benign Het
Tcof1 GC GCTGCTGAGATGGGCACTTTCCCAGAGATCCCCTTGTC 18: 60,833,583 probably benign Het
Tfeb GCA GCAACA 17: 47,786,097 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,110 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCATCA 17: 47,786,112 probably benign Het
Tgoln1 T TCACCTCCCGTGGTCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tmem59 TTTGTTT TTTGTTTGGTTGTTT 4: 107,190,526 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 15: 72,801,292 probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,967,063 probably benign Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 108,956,101 probably benign Het
Other mutations in Smarca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Smarca2 APN 19 26774294 missense possibly damaging 0.82
IGL01907:Smarca2 APN 19 26698465 missense possibly damaging 0.59
IGL02039:Smarca2 APN 19 26716137 missense probably damaging 1.00
IGL02110:Smarca2 APN 19 26672740 missense possibly damaging 0.96
IGL02561:Smarca2 APN 19 26716182 missense possibly damaging 0.92
IGL02649:Smarca2 APN 19 26640586 missense possibly damaging 0.73
IGL02880:Smarca2 APN 19 26676624 splice site probably benign
IGL03028:Smarca2 APN 19 26678312 splice site probably benign
IGL03187:Smarca2 APN 19 26672824 missense probably damaging 0.98
IGL03213:Smarca2 APN 19 26623975 missense probably damaging 1.00
IGL03354:Smarca2 APN 19 26619903 missense probably benign 0.01
FR4737:Smarca2 UTSW 19 26630999 unclassified probably benign
PIT1430001:Smarca2 UTSW 19 26649093 missense probably benign 0.35
R0184:Smarca2 UTSW 19 26692249 nonsense probably null
R0306:Smarca2 UTSW 19 26640613 missense probably damaging 1.00
R0538:Smarca2 UTSW 19 26691362 missense probably damaging 0.99
R0565:Smarca2 UTSW 19 26681875 missense possibly damaging 0.71
R0610:Smarca2 UTSW 19 26691391 missense probably damaging 1.00
R0669:Smarca2 UTSW 19 26706200 missense possibly damaging 0.51
R0726:Smarca2 UTSW 19 26698403 missense probably damaging 1.00
R1184:Smarca2 UTSW 19 26770933 splice site probably benign
R1256:Smarca2 UTSW 19 26681973 missense probably benign 0.06
R1299:Smarca2 UTSW 19 26771611 critical splice donor site probably null
R1306:Smarca2 UTSW 19 26770988 missense possibly damaging 0.81
R1381:Smarca2 UTSW 19 26630828 missense probably damaging 1.00
R1400:Smarca2 UTSW 19 26676740 missense probably damaging 0.98
R1415:Smarca2 UTSW 19 26710684 missense probably null 0.72
R1496:Smarca2 UTSW 19 26631101 missense possibly damaging 0.85
R1582:Smarca2 UTSW 19 26751905 missense probably damaging 0.99
R1666:Smarca2 UTSW 19 26647034 missense possibly damaging 0.65
R1668:Smarca2 UTSW 19 26647034 missense possibly damaging 0.65
R1751:Smarca2 UTSW 19 26640380 splice site probably benign
R1861:Smarca2 UTSW 19 26623884 missense probably benign 0.03
R1962:Smarca2 UTSW 19 26672724 nonsense probably null
R1964:Smarca2 UTSW 19 26672724 nonsense probably null
R1998:Smarca2 UTSW 19 26631093 missense probably benign 0.33
R2014:Smarca2 UTSW 19 26683905 missense possibly damaging 0.86
R2255:Smarca2 UTSW 19 26771038 missense probably benign 0.01
R2392:Smarca2 UTSW 19 26640650 critical splice donor site probably null
R2439:Smarca2 UTSW 19 26691454 critical splice donor site probably null
R3030:Smarca2 UTSW 19 26752029 missense possibly damaging 0.84
R3195:Smarca2 UTSW 19 26683822 missense possibly damaging 0.85
R3430:Smarca2 UTSW 19 26691349 missense probably damaging 1.00
R3710:Smarca2 UTSW 19 26668890 unclassified probably benign
R3845:Smarca2 UTSW 19 26720873 missense probably benign 0.06
R4013:Smarca2 UTSW 19 26683927 splice site probably null
R4014:Smarca2 UTSW 19 26683927 splice site probably null
R4016:Smarca2 UTSW 19 26683927 splice site probably null
R4271:Smarca2 UTSW 19 26720949 critical splice donor site probably null
R4471:Smarca2 UTSW 19 26619877 missense possibly damaging 0.86
R4612:Smarca2 UTSW 19 26776225 missense possibly damaging 0.70
R4730:Smarca2 UTSW 19 26630673 missense probably damaging 1.00
R4755:Smarca2 UTSW 19 26654483 missense possibly damaging 0.86
R4999:Smarca2 UTSW 19 26720855 nonsense probably null
R5015:Smarca2 UTSW 19 26691388 missense possibly damaging 0.86
R5320:Smarca2 UTSW 19 26691372 missense probably damaging 1.00
R5393:Smarca2 UTSW 19 26640429 missense probably benign 0.18
R5503:Smarca2 UTSW 19 26623936 missense probably damaging 0.96
R5503:Smarca2 UTSW 19 26682046 missense possibly damaging 0.93
R5715:Smarca2 UTSW 19 26649122 missense probably benign 0.16
R5790:Smarca2 UTSW 19 26676724 missense probably damaging 1.00
R5874:Smarca2 UTSW 19 26776069 intron probably benign
R6209:Smarca2 UTSW 19 26771004 nonsense probably null
R6236:Smarca2 UTSW 19 26696213 missense probably benign 0.33
R6291:Smarca2 UTSW 19 26630892 missense probably damaging 1.00
R6292:Smarca2 UTSW 19 26630892 missense probably damaging 1.00
R6325:Smarca2 UTSW 19 26678363 missense probably damaging 0.99
R6544:Smarca2 UTSW 19 26630931 missense probably damaging 1.00
R6572:Smarca2 UTSW 19 26679173 missense possibly damaging 0.71
R6589:Smarca2 UTSW 19 26619884 missense possibly damaging 0.53
R6601:Smarca2 UTSW 19 26654377 missense probably benign 0.30
R6804:Smarca2 UTSW 19 26751886 missense possibly damaging 0.93
R6922:Smarca2 UTSW 19 26691349 missense probably damaging 1.00
R7047:Smarca2 UTSW 19 26669155 missense possibly damaging 0.83
R7213:Smarca2 UTSW 19 26647131 missense possibly damaging 0.96
R7257:Smarca2 UTSW 19 26654464 nonsense probably null
R7259:Smarca2 UTSW 19 26654464 nonsense probably null
R7479:Smarca2 UTSW 19 26640487 missense probably benign 0.00
R7512:Smarca2 UTSW 19 26683809 missense possibly damaging 0.51
R8158:Smarca2 UTSW 19 26682048 missense probably benign 0.16
R8182:Smarca2 UTSW 19 26630720 missense probably benign 0.39
R8207:Smarca2 UTSW 19 26676680 missense possibly damaging 0.71
RF001:Smarca2 UTSW 19 26630986 unclassified probably benign
RF001:Smarca2 UTSW 19 26631021 unclassified probably benign
RF004:Smarca2 UTSW 19 26631020 unclassified probably benign
RF019:Smarca2 UTSW 19 26631001 unclassified probably benign
RF021:Smarca2 UTSW 19 26630997 unclassified probably benign
RF024:Smarca2 UTSW 19 26631020 unclassified probably benign
RF034:Smarca2 UTSW 19 26631011 unclassified probably benign
RF041:Smarca2 UTSW 19 26631021 unclassified probably benign
RF047:Smarca2 UTSW 19 26631005 unclassified probably benign
RF051:Smarca2 UTSW 19 26630988 unclassified probably benign
X0061:Smarca2 UTSW 19 26720840 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAACAGAGGTCCCTCGCCTTTC -3'
(R):5'- AGTAACCAAGTGCTTCTGTGTG -3'

Sequencing Primer
(F):5'- TCAGTCCTGTGCAGCTGC -3'
(R):5'- CCAAGTGCTTCTGTGTGCAAGAG -3'
Posted On2019-12-04