Incidental Mutation 'RF040:Morn4'
Institutional Source Beutler Lab
Gene Symbol Morn4
Ensembl Gene ENSMUSG00000049670
Gene NameMORN repeat containing 4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #RF040 (G1)
Quality Score214.458
Status Not validated
Chromosomal Location42074939-42086370 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) GCAGTGAG to GCAGTGAGTCAGTCAGTGAG at 42076111 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051772]
Predicted Effect probably null
Transcript: ENSMUST00000051772
SMART Domains Protein: ENSMUSP00000062887
Gene: ENSMUSG00000049670

MORN 14 35 1.64e-5 SMART
MORN 37 58 4.15e-2 SMART
MORN 60 81 1.86e-4 SMART
MORN 83 104 1.84e0 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik TG TGTCAGGGCAGCAGCAG 8: 84,167,575 probably benign Het
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,913,577 probably benign Het
A030005L19Rik G GTGGCTGCTC 1: 82,913,590 probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,618,971 probably null Het
Calhm1 C CTGTGGCTGTGGA 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dnajc2 TAGTTG T 5: 21,757,697 probably null Het
Fam71e1 C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,500,521 probably null Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Heatr3 TAT TATTGAT 8: 88,156,457 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Luzp1 A AGGTGGCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 AACA AACAACA X: 71,118,814 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l AGC AGCCGC 3: 59,275,967 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,081,363 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Olfr625-ps1 ACTTGCTGATATCTT ACTT 7: 103,682,938 probably null Het
Osmr TTCT TTCTTCT 15: 6,837,701 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l AC ACCACCGC 4: 134,279,515 probably benign Het
Rpgrip1 AGGAAGAGG AG 14: 52,149,537 probably null Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Smarca2 GC GCCCCACC 19: 26,631,022 probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,317,564 probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 probably benign Het
Tcof1 CT CTATT 18: 60,828,408 probably benign Het
Tfeb GCA GCAACA 17: 47,786,097 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,110 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCATCA 17: 47,786,112 probably benign Het
Tgoln1 T TCACCTCCCGTGGTCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tmem59 TTTGTTT TTTGTTTGGTTGTTT 4: 107,190,526 probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,967,063 probably benign Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 108,956,101 probably benign Het
Other mutations in Morn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Morn4 APN 19 42076120 missense possibly damaging 0.53
IGL02572:Morn4 APN 19 42076447 splice site probably benign
IGL02933:Morn4 APN 19 42076222 missense probably benign 0.01
FR4449:Morn4 UTSW 19 42076109 small insertion probably benign
FR4548:Morn4 UTSW 19 42076109 small insertion probably benign
R1997:Morn4 UTSW 19 42076538 missense possibly damaging 0.71
R2239:Morn4 UTSW 19 42078032 missense possibly damaging 0.93
R4409:Morn4 UTSW 19 42078547 missense possibly damaging 0.53
R5544:Morn4 UTSW 19 42076247 missense possibly damaging 0.71
R5695:Morn4 UTSW 19 42076117 missense possibly damaging 0.96
R6986:Morn4 UTSW 19 42078014 missense possibly damaging 0.71
R7024:Morn4 UTSW 19 42078044 missense possibly damaging 0.92
RF025:Morn4 UTSW 19 42076111 nonsense probably null
RF030:Morn4 UTSW 19 42076111 nonsense probably null
RF036:Morn4 UTSW 19 42076114 nonsense probably null
RF042:Morn4 UTSW 19 42076111 nonsense probably null
RF044:Morn4 UTSW 19 42076114 nonsense probably null
RF057:Morn4 UTSW 19 42076106 nonsense probably null
X0063:Morn4 UTSW 19 42077968 missense possibly damaging 0.71
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04