Incidental Mutation 'RF040:Calhm1'
ID 604797
Institutional Source Beutler Lab
Gene Symbol Calhm1
Ensembl Gene ENSMUSG00000079258
Gene Name calcium homeostasis modulator 1
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF040 (G1)
Quality Score 217.47
Status Not validated
Chromosome 19
Chromosomal Location 47129474-47132613 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to CTGTGGCTGTGGA at 47129716 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035822] [ENSMUST00000111813] [ENSMUST00000140512]
AlphaFold D3Z291
Predicted Effect probably benign
Transcript: ENSMUST00000035822
SMART Domains Protein: ENSMUSP00000047278
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 256 2.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111813
SMART Domains Protein: ENSMUSP00000107444
Gene: ENSMUSG00000079258

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 1 255 5.6e-94 PFAM
low complexity region 267 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140512
SMART Domains Protein: ENSMUSP00000121661
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 258 2.9e-93 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium channel that plays a role in processing of amyloid-beta precursor protein. A polymorphism at this locus has been reported to be associated with susceptibility to late-onset Alzheimer's disease in some populations, but the pathogenicity of this polymorphism is unclear.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered cortical neuron electrical properties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,891,298 (GRCm39) probably benign Het
A030005L19Rik G GTGGCTGCTC 1: 82,891,311 (GRCm39) probably benign Het
Brme1 TG TGTCAGGGCAGCAGCAG 8: 84,894,204 (GRCm39) probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,485,210 (GRCm39) probably null Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,152,942 (GRCm39) probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 86,922,462 (GRCm39) probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,465,750 (GRCm39) probably null Het
Dnajc2 TAGTTG T 5: 21,962,695 (GRCm39) probably null Het
Fgd6 ATT A 10: 93,880,187 (GRCm39) probably null Het
Flywch1 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAGTCCTGGTGT 17: 23,981,143 (GRCm39) probably null Het
Gab3 CTT CTTTTT X: 74,043,633 (GRCm39) probably benign Het
Garin5a C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,149,945 (GRCm39) probably null Het
Garin5a GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,149,955 (GRCm39) probably null Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Gykl1 G A 18: 52,827,488 (GRCm39) R232Q probably benign Het
Heatr3 TAT TATTGAT 8: 88,883,085 (GRCm39) probably benign Het
Kmt2e TTT TTTTCTT 5: 23,683,507 (GRCm39) probably benign Het
Luzp1 A AGGTGGCCTCTTCAGC 4: 136,270,507 (GRCm39) probably benign Het
Mamld1 AACA AACAACA X: 70,162,420 (GRCm39) probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,875,749 (GRCm39) probably benign Het
Med12l AGC AGCCGC 3: 59,183,388 (GRCm39) probably benign Het
Med12l GCA GCATCA 3: 59,183,410 (GRCm39) probably benign Het
Mn1 CAG CAGAAG 5: 111,567,571 (GRCm39) probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,064,550 (GRCm39) probably null Het
Ncoa6 TGCAGC TGC 2: 155,263,651 (GRCm39) probably benign Het
Nlrp3 GGGTA G 11: 59,449,378 (GRCm39) probably null Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,069,802 (GRCm39) probably benign Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,458,068 (GRCm39) probably benign Het
Or10j2 GTGACATC G 1: 173,098,276 (GRCm39) probably null Het
Or52z15 ACTTGCTGATATCTT ACTT 7: 103,332,145 (GRCm39) probably null Het
Osmr TTCT TTCTTCT 15: 6,867,182 (GRCm39) probably benign Het
Padi3 TCTCAC TC 4: 140,520,283 (GRCm39) probably benign Het
Pdik1l AC ACCACCGC 4: 134,006,826 (GRCm39) probably benign Het
Rpgrip1 AGGAAGAGG AG 14: 52,386,994 (GRCm39) probably null Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 (GRCm39) probably benign Het
Ryr3 CTGA C 2: 112,740,869 (GRCm39) probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,373,055 (GRCm39) probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,499,066 (GRCm39) probably benign Het
Smarca2 GC GCCCCACC 19: 26,608,422 (GRCm39) probably benign Het
Spata31f3 TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 (GRCm39) probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,224,871 (GRCm39) probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 (GRCm39) probably benign Het
Tcof1 CT CTATT 18: 60,961,480 (GRCm39) probably benign Het
Tcof1 GC GCTGCTGAGATGGGCACTTTCCCAGAGATCCCCTTGTC 18: 60,966,655 (GRCm39) probably benign Het
Tfeb AGC AGCCGC 17: 48,097,036 (GRCm39) probably benign Het
Tfeb GCA GCATCA 17: 48,097,037 (GRCm39) probably benign Het
Tfeb GCA GCAACA 17: 48,097,022 (GRCm39) probably benign Het
Tfeb CAG CAGGAG 17: 48,097,035 (GRCm39) probably benign Het
Tgoln1 T TCACCTCCCGTGGTCTTGCCAGAAG 6: 72,593,057 (GRCm39) probably benign Het
Tmem59 TTTGTTT TTTGTTTGGTTGTTT 4: 107,047,723 (GRCm39) probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 15: 72,673,141 (GRCm39) probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,851,263 (GRCm39) probably benign Het
Xirp2 TT TTTAT 2: 67,355,888 (GRCm39) probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 109,682,733 (GRCm39) probably benign Het
Other mutations in Calhm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4340:Calhm1 UTSW 19 47,129,690 (GRCm39) unclassified probably benign
FR4449:Calhm1 UTSW 19 47,129,713 (GRCm39) unclassified probably benign
FR4976:Calhm1 UTSW 19 47,129,701 (GRCm39) unclassified probably benign
R0328:Calhm1 UTSW 19 47,129,742 (GRCm39) missense possibly damaging 0.46
R0402:Calhm1 UTSW 19 47,129,896 (GRCm39) missense probably damaging 0.98
R0463:Calhm1 UTSW 19 47,132,280 (GRCm39) missense probably benign 0.16
R0608:Calhm1 UTSW 19 47,132,280 (GRCm39) missense probably benign 0.16
R1552:Calhm1 UTSW 19 47,129,640 (GRCm39) missense probably benign 0.00
R4647:Calhm1 UTSW 19 47,132,240 (GRCm39) missense probably damaging 0.98
R4648:Calhm1 UTSW 19 47,132,240 (GRCm39) missense probably damaging 0.98
R5762:Calhm1 UTSW 19 47,132,058 (GRCm39) splice site probably null
R5766:Calhm1 UTSW 19 47,132,142 (GRCm39) missense probably benign 0.00
R9062:Calhm1 UTSW 19 47,129,828 (GRCm39) missense possibly damaging 0.64
RF001:Calhm1 UTSW 19 47,129,715 (GRCm39) unclassified probably benign
RF010:Calhm1 UTSW 19 47,129,712 (GRCm39) unclassified probably benign
RF014:Calhm1 UTSW 19 47,129,704 (GRCm39) unclassified probably benign
RF015:Calhm1 UTSW 19 47,129,695 (GRCm39) unclassified probably benign
RF023:Calhm1 UTSW 19 47,129,712 (GRCm39) unclassified probably benign
RF025:Calhm1 UTSW 19 47,129,716 (GRCm39) unclassified probably benign
RF025:Calhm1 UTSW 19 47,129,715 (GRCm39) unclassified probably benign
RF030:Calhm1 UTSW 19 47,129,692 (GRCm39) unclassified probably benign
RF032:Calhm1 UTSW 19 47,129,722 (GRCm39) frame shift probably null
RF035:Calhm1 UTSW 19 47,129,692 (GRCm39) unclassified probably benign
RF036:Calhm1 UTSW 19 47,129,716 (GRCm39) unclassified probably benign
RF050:Calhm1 UTSW 19 47,129,709 (GRCm39) unclassified probably benign
RF057:Calhm1 UTSW 19 47,129,709 (GRCm39) unclassified probably benign
RF063:Calhm1 UTSW 19 47,129,695 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGCTCATCAGTGGTGCCTC -3'
(R):5'- GACCACATTACTAGCGTTCGTGG -3'

Sequencing Primer
(F):5'- ATTCATGGTGCCTTGGTC -3'
(R):5'- CACGCAGGTCGCCTTTC -3'
Posted On 2019-12-04