Incidental Mutation 'RF040:Calhm1'
ID604797
Institutional Source Beutler Lab
Gene Symbol Calhm1
Ensembl Gene ENSMUSG00000079258
Gene Namecalcium homeostasis modulator 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF040 (G1)
Quality Score217.47
Status Not validated
Chromosome19
Chromosomal Location47141035-47144174 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to CTGTGGCTGTGGA at 47141277 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035822] [ENSMUST00000111813] [ENSMUST00000140512]
Predicted Effect probably benign
Transcript: ENSMUST00000035822
SMART Domains Protein: ENSMUSP00000047278
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 256 2.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111813
SMART Domains Protein: ENSMUSP00000107444
Gene: ENSMUSG00000079258

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 1 255 5.6e-94 PFAM
low complexity region 267 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140512
SMART Domains Protein: ENSMUSP00000121661
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 258 2.9e-93 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium channel that plays a role in processing of amyloid-beta precursor protein. A polymorphism at this locus has been reported to be associated with susceptibility to late-onset Alzheimer's disease in some populations, but the pathogenicity of this polymorphism is unclear.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered cortical neuron electrical properties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik TG TGTCAGGGCAGCAGCAG 8: 84,167,575 probably benign Het
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,913,577 probably benign Het
A030005L19Rik G GTGGCTGCTC 1: 82,913,590 probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,618,971 probably null Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dnajc2 TAGTTG T 5: 21,757,697 probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam71e1 C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,500,521 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Flywch1 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAGTCCTGGTGT 17: 23,762,169 probably null Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Heatr3 TAT TATTGAT 8: 88,156,457 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Luzp1 A AGGTGGCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 AACA AACAACA X: 71,118,814 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l AGC AGCCGC 3: 59,275,967 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,081,363 probably benign Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Olfr625-ps1 ACTTGCTGATATCTT ACTT 7: 103,682,938 probably null Het
Osmr TTCT TTCTTCT 15: 6,837,701 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l AC ACCACCGC 4: 134,279,515 probably benign Het
Rpgrip1 AGGAAGAGG AG 14: 52,149,537 probably null Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 GC GCCCCACC 19: 26,631,022 probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,317,564 probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 probably benign Het
Tcof1 CT CTATT 18: 60,828,408 probably benign Het
Tcof1 GC GCTGCTGAGATGGGCACTTTCCCAGAGATCCCCTTGTC 18: 60,833,583 probably benign Het
Tfeb GCA GCAACA 17: 47,786,097 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,110 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCATCA 17: 47,786,112 probably benign Het
Tgoln1 T TCACCTCCCGTGGTCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tmem59 TTTGTTT TTTGTTTGGTTGTTT 4: 107,190,526 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 15: 72,801,292 probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,967,063 probably benign Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 108,956,101 probably benign Het
Other mutations in Calhm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4340:Calhm1 UTSW 19 47141251 unclassified probably benign
FR4449:Calhm1 UTSW 19 47141274 unclassified probably benign
FR4976:Calhm1 UTSW 19 47141262 unclassified probably benign
R0328:Calhm1 UTSW 19 47141303 missense possibly damaging 0.46
R0402:Calhm1 UTSW 19 47141457 missense probably damaging 0.98
R0463:Calhm1 UTSW 19 47143841 missense probably benign 0.16
R0608:Calhm1 UTSW 19 47143841 missense probably benign 0.16
R1552:Calhm1 UTSW 19 47141201 missense probably benign 0.00
R4647:Calhm1 UTSW 19 47143801 missense probably damaging 0.98
R4648:Calhm1 UTSW 19 47143801 missense probably damaging 0.98
R5762:Calhm1 UTSW 19 47143619 splice site probably null
R5766:Calhm1 UTSW 19 47143703 missense probably benign 0.00
RF001:Calhm1 UTSW 19 47141276 unclassified probably benign
RF010:Calhm1 UTSW 19 47141273 unclassified probably benign
RF014:Calhm1 UTSW 19 47141265 unclassified probably benign
RF015:Calhm1 UTSW 19 47141256 unclassified probably benign
RF023:Calhm1 UTSW 19 47141273 unclassified probably benign
RF025:Calhm1 UTSW 19 47141276 unclassified probably benign
RF025:Calhm1 UTSW 19 47141277 unclassified probably benign
RF030:Calhm1 UTSW 19 47141253 unclassified probably benign
RF032:Calhm1 UTSW 19 47141283 frame shift probably null
RF035:Calhm1 UTSW 19 47141253 unclassified probably benign
RF036:Calhm1 UTSW 19 47141277 unclassified probably benign
RF050:Calhm1 UTSW 19 47141270 unclassified probably benign
RF057:Calhm1 UTSW 19 47141270 unclassified probably benign
RF063:Calhm1 UTSW 19 47141256 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGCTCATCAGTGGTGCCTC -3'
(R):5'- GACCACATTACTAGCGTTCGTGG -3'

Sequencing Primer
(F):5'- ATTCATGGTGCCTTGGTC -3'
(R):5'- CACGCAGGTCGCCTTTC -3'
Posted On2019-12-04