Incidental Mutation 'RF040:Gab3'
ID604800
Institutional Source Beutler Lab
Gene Symbol Gab3
Ensembl Gene ENSMUSG00000032750
Gene Namegrowth factor receptor bound protein 2-associated protein 3
Synonyms5930433H21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF040 (G1)
Quality Score180.468
Status Not validated
ChromosomeX
Chromosomal Location74966843-75085458 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CTT to CTTTTT at 75000027 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037374] [ENSMUST00000114104] [ENSMUST00000114109]
Predicted Effect probably benign
Transcript: ENSMUST00000037374
SMART Domains Protein: ENSMUSP00000041951
Gene: ENSMUSG00000032750

DomainStartEndE-ValueType
PH 6 119 3.2e-21 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 307 314 N/A INTRINSIC
low complexity region 424 435 N/A INTRINSIC
coiled coil region 494 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114104
SMART Domains Protein: ENSMUSP00000109739
Gene: ENSMUSG00000032750

DomainStartEndE-ValueType
PH 6 119 3.2e-21 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 307 314 N/A INTRINSIC
low complexity region 424 435 N/A INTRINSIC
coiled coil region 495 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114109
SMART Domains Protein: ENSMUSP00000109744
Gene: ENSMUSG00000032750

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
coiled coil region 97 123 N/A INTRINSIC
Pfam:Pcc1 170 228 1.1e-9 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the GRB2-associated binding protein gene family. These proteins are scaffolding/docking proteins that are involved in several growth factor and cytokine signaling pathways, and they contain a pleckstrin homology domain, and bind SHP2 tyrosine phosphatase and GRB2 adapter protein. The protein encoded by this gene facilitates macrophage differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Females homozygous and males hemizygous for disruptions in this X-linked gene developed normally, exhibted normal hematopoiesis, and were immunocompetent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik TG TGTCAGGGCAGCAGCAG 8: 84,167,575 probably benign Het
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,913,577 probably benign Het
A030005L19Rik G GTGGCTGCTC 1: 82,913,590 probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,618,971 probably null Het
Calhm1 C CTGTGGCTGTGGA 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dnajc2 TAGTTG T 5: 21,757,697 probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam71e1 C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,500,521 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Flywch1 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAGTCCTGGTGT 17: 23,762,169 probably null Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Heatr3 TAT TATTGAT 8: 88,156,457 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Luzp1 A AGGTGGCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 AACA AACAACA X: 71,118,814 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l AGC AGCCGC 3: 59,275,967 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,081,363 probably benign Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Olfr625-ps1 ACTTGCTGATATCTT ACTT 7: 103,682,938 probably null Het
Osmr TTCT TTCTTCT 15: 6,837,701 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l AC ACCACCGC 4: 134,279,515 probably benign Het
Rpgrip1 AGGAAGAGG AG 14: 52,149,537 probably null Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 GC GCCCCACC 19: 26,631,022 probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,317,564 probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 probably benign Het
Tcof1 CT CTATT 18: 60,828,408 probably benign Het
Tcof1 GC GCTGCTGAGATGGGCACTTTCCCAGAGATCCCCTTGTC 18: 60,833,583 probably benign Het
Tfeb GCA GCAACA 17: 47,786,097 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,110 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCATCA 17: 47,786,112 probably benign Het
Tgoln1 T TCACCTCCCGTGGTCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tmem59 TTTGTTT TTTGTTTGGTTGTTT 4: 107,190,526 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 15: 72,801,292 probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,967,063 probably benign Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 108,956,101 probably benign Het
Other mutations in Gab3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Gab3 APN X 75005359 missense probably benign 0.00
R0894:Gab3 UTSW X 75033418 missense probably damaging 1.00
R2069:Gab3 UTSW X 75000095 missense probably damaging 1.00
R2102:Gab3 UTSW X 74999979 small insertion probably benign
RF001:Gab3 UTSW X 75000018 small insertion probably benign
RF003:Gab3 UTSW X 75000006 nonsense probably null
RF006:Gab3 UTSW X 75000027 small insertion probably benign
RF007:Gab3 UTSW X 74999996 small insertion probably benign
RF007:Gab3 UTSW X 75000011 small insertion probably benign
RF007:Gab3 UTSW X 75000025 small insertion probably benign
RF009:Gab3 UTSW X 74999992 small insertion probably benign
RF009:Gab3 UTSW X 75000024 nonsense probably null
RF010:Gab3 UTSW X 75000011 small insertion probably benign
RF012:Gab3 UTSW X 75000020 small insertion probably benign
RF016:Gab3 UTSW X 74999985 nonsense probably null
RF020:Gab3 UTSW X 75000017 small insertion probably benign
RF022:Gab3 UTSW X 74999994 nonsense probably null
RF025:Gab3 UTSW X 75000008 small insertion probably benign
RF026:Gab3 UTSW X 74999990 small insertion probably benign
RF026:Gab3 UTSW X 75000023 small insertion probably benign
RF028:Gab3 UTSW X 75000000 nonsense probably null
RF028:Gab3 UTSW X 75000017 small insertion probably benign
RF030:Gab3 UTSW X 74999977 small deletion probably benign
RF030:Gab3 UTSW X 75000005 small insertion probably benign
RF030:Gab3 UTSW X 75000008 small insertion probably benign
RF030:Gab3 UTSW X 75000025 small insertion probably benign
RF030:Gab3 UTSW X 75000026 small insertion probably benign
RF031:Gab3 UTSW X 74999996 small insertion probably benign
RF031:Gab3 UTSW X 74999997 nonsense probably null
RF031:Gab3 UTSW X 75000001 small insertion probably benign
RF033:Gab3 UTSW X 75000001 small insertion probably benign
RF033:Gab3 UTSW X 75000023 small insertion probably benign
RF039:Gab3 UTSW X 75000004 small insertion probably benign
RF042:Gab3 UTSW X 75000005 small insertion probably benign
RF042:Gab3 UTSW X 75000022 small insertion probably benign
RF044:Gab3 UTSW X 75000005 small insertion probably benign
RF047:Gab3 UTSW X 74999993 small insertion probably benign
RF052:Gab3 UTSW X 74999983 small insertion probably benign
RF055:Gab3 UTSW X 74999987 small insertion probably benign
RF055:Gab3 UTSW X 75000010 small insertion probably benign
RF058:Gab3 UTSW X 75000002 small insertion probably benign
RF059:Gab3 UTSW X 74999990 small insertion probably benign
RF060:Gab3 UTSW X 75000013 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CGGTGACCTGGTTTTATAATAAGC -3'
(R):5'- TTTGGAAGGAACAGGCTCAAACC -3'

Sequencing Primer
(F):5'- AAGCCATTCTTTATGACTGCACAC -3'
(R):5'- CCCACAGGGCTGTCTGTTC -3'
Posted On2019-12-04