Incidental Mutation 'RF041:Nusap1'
ID 604804
Institutional Source Beutler Lab
Gene Symbol Nusap1
Ensembl Gene ENSMUSG00000027306
Gene Name nucleolar and spindle associated protein 1
Synonyms 2610201A12Rik, NuSAP
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF041 (G1)
Quality Score 194.468
Status Not validated
Chromosome 2
Chromosomal Location 119618298-119651244 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) GAGA to GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA at 119627607 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028771] [ENSMUST00000068225]
AlphaFold Q9ERH4
Predicted Effect probably null
Transcript: ENSMUST00000028771
SMART Domains Protein: ENSMUSP00000028771
Gene: ENSMUSG00000027306

low complexity region 28 43 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 119 129 N/A INTRINSIC
coiled coil region 360 392 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000068225
SMART Domains Protein: ENSMUSP00000068713
Gene: ENSMUSG00000027306

low complexity region 28 43 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 119 129 N/A INTRINSIC
Pfam:NUSAP 167 261 6e-27 PFAM
Pfam:NUSAP 256 421 2.3e-72 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUSAP1 is a nucleolar-spindle-associated protein that plays a role in spindle microtubule organization (Raemaekers et al., 2003 [PubMed 12963707]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Early embryos homozygous for a knock-out allele are small and exhibit disorganized embryonic tissue, abnormal chromatin-induced spindle assembly, abnormal inner cell mass apoptosis, and complete embryonic lethality at implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik TGAGGA TGA 12: 72,881,276 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GGCTGC GGCTGCGGCATCCTGTGCTGC 4: 155,905,100 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,229 probably benign Het
Arid1b CGG CGGTGG 17: 4,995,595 probably benign Het
AY761185 CACTGTGGG C 8: 20,943,912 probably null Het
Btnl1 C T 17: 34,381,368 T246M probably benign Het
Cdc40 C T 10: 40,843,123 D337N probably damaging Het
Cul9 CCT CCTACT 17: 46,500,854 probably null Het
Flywch1 GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT 17: 23,762,177 probably null Het
Gabre CTCCGG CTCCGGATCCGG X: 72,270,049 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,758 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Il2 GG GGGCTTGAAGTGCG 3: 37,125,842 probably benign Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
Kmt2c TG TGTTGCAG 5: 25,315,775 probably benign Het
Lce1m CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC 3: 93,018,141 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,829 probably benign Het
Med12l AGC AGCTGC 3: 59,275,985 probably benign Het
Med12l GC GCACC 3: 59,275,995 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTCGTGGTGGT 7: 127,785,332 probably benign Het
Smarca2 AGC AGCCCCTGC 19: 26,631,021 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Other mutations in Nusap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Nusap1 APN 2 119648890 splice site probably benign
IGL02582:Nusap1 APN 2 119648989 makesense probably null
IGL02732:Nusap1 APN 2 119635580 missense probably damaging 0.96
IGL02794:Nusap1 APN 2 119630386 missense possibly damaging 0.80
R0635:Nusap1 UTSW 2 119627667 missense probably damaging 0.98
R2567:Nusap1 UTSW 2 119643830 missense possibly damaging 0.70
R3162:Nusap1 UTSW 2 119630404 missense possibly damaging 0.86
R3162:Nusap1 UTSW 2 119630404 missense possibly damaging 0.86
R3895:Nusap1 UTSW 2 119627691 missense possibly damaging 0.94
R4296:Nusap1 UTSW 2 119639648 missense probably damaging 1.00
R5111:Nusap1 UTSW 2 119630356 nonsense probably null
R5417:Nusap1 UTSW 2 119647143 missense probably damaging 0.98
R5754:Nusap1 UTSW 2 119647099 missense probably damaging 1.00
R5818:Nusap1 UTSW 2 119635513 missense possibly damaging 0.85
R6176:Nusap1 UTSW 2 119630421 missense probably benign 0.01
R7947:Nusap1 UTSW 2 119647135 missense possibly damaging 0.95
R9010:Nusap1 UTSW 2 119648975 missense possibly damaging 0.91
R9312:Nusap1 UTSW 2 119627638 small deletion probably benign
RF003:Nusap1 UTSW 2 119627603 small insertion probably benign
RF007:Nusap1 UTSW 2 119627581 small insertion probably benign
RF010:Nusap1 UTSW 2 119627584 small insertion probably benign
RF016:Nusap1 UTSW 2 119627601 small insertion probably benign
RF018:Nusap1 UTSW 2 119627578 small insertion probably benign
RF026:Nusap1 UTSW 2 119627590 small insertion probably benign
RF026:Nusap1 UTSW 2 119627604 small insertion probably benign
RF028:Nusap1 UTSW 2 119627578 small insertion probably benign
RF028:Nusap1 UTSW 2 119627591 small insertion probably benign
RF029:Nusap1 UTSW 2 119627594 small insertion probably benign
RF029:Nusap1 UTSW 2 119627605 small insertion probably benign
RF032:Nusap1 UTSW 2 119627587 small insertion probably benign
RF033:Nusap1 UTSW 2 119627600 small insertion probably benign
RF035:Nusap1 UTSW 2 119627579 small insertion probably benign
RF036:Nusap1 UTSW 2 119627587 small insertion probably benign
RF036:Nusap1 UTSW 2 119627594 small insertion probably benign
RF037:Nusap1 UTSW 2 119627589 small insertion probably benign
RF040:Nusap1 UTSW 2 119627587 small insertion probably benign
RF041:Nusap1 UTSW 2 119627579 small insertion probably benign
RF041:Nusap1 UTSW 2 119627593 small insertion probably benign
RF042:Nusap1 UTSW 2 119627607 nonsense probably null
RF043:Nusap1 UTSW 2 119627592 small insertion probably benign
RF045:Nusap1 UTSW 2 119627610 small insertion probably benign
RF046:Nusap1 UTSW 2 119627595 nonsense probably null
RF048:Nusap1 UTSW 2 119627599 small insertion probably benign
RF049:Nusap1 UTSW 2 119627583 small insertion probably benign
RF052:Nusap1 UTSW 2 119627584 small insertion probably benign
RF056:Nusap1 UTSW 2 119627581 small insertion probably benign
RF056:Nusap1 UTSW 2 119627586 small insertion probably benign
RF056:Nusap1 UTSW 2 119627591 small insertion probably benign
RF062:Nusap1 UTSW 2 119627601 small insertion probably benign
RF062:Nusap1 UTSW 2 119627610 small insertion probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04