Incidental Mutation 'RF041:Kif12'
ID 604811
Institutional Source Beutler Lab
Gene Symbol Kif12
Ensembl Gene ENSMUSG00000028357
Gene Name kinesin family member 12
Synonyms N-9 kinesin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock # RF041 (G1)
Quality Score 214.458
Status Not validated
Chromosome 4
Chromosomal Location 63165630-63172131 bp(-) (GRCm38)
Type of Mutation small insertion (5 aa in frame mutation)
DNA Base Change (assembly) GGC to GGCCTCCACCCGGCGTGC at 63171425 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030042] [ENSMUST00000124739] [ENSMUST00000156618]
AlphaFold Q9D2Z8
Predicted Effect probably benign
Transcript: ENSMUST00000030042
SMART Domains Protein: ENSMUSP00000030042
Gene: ENSMUSG00000028357

DomainStartEndE-ValueType
KISc 23 368 4.46e-108 SMART
coiled coil region 376 464 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124739
Predicted Effect probably benign
Transcript: ENSMUST00000154234
Predicted Effect probably benign
Transcript: ENSMUST00000156618
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily of microtubule-associated molecular motors with functions related to the microtubule cytosekelton. Members of this superfamily play important roles in intracellular transport and cell division. A similar protein in mouse functions in the beta cell antioxidant signaling cascade, acting as a scaffold for the transcription factor specificity protein 1 (Sp1). Mice that lack this gene exhibit beta cell oxidative stress resulting in hypoinsulinemic glucose intolerance. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik TGAGGA TGA 12: 72,881,276 probably benign Het
5430401F13Rik CCAGCAAAAACAGAAAGGAAAAGG CCAGCAAAAACAGAAAGGAAAAGGAGGCCAGCAAAAACAGAAAGGAAAAGG 6: 131,552,873 probably benign Het
5430401F13Rik AAAGGTGGC AAAGGTGGCAAGCAAAAACAGAAAGGAGAAGGTGGC 6: 131,552,892 probably benign Het
5430401F13Rik AGGTGGCCAG AGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,894 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GGCTGC GGCTGCGGCATCCTGTGCTGC 4: 155,905,100 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,229 probably benign Het
Arid1b CGG CGGTGG 17: 4,995,595 probably benign Het
AY761185 CACTGTGGG C 8: 20,943,912 probably null Het
Btnl1 C T 17: 34,381,368 T246M probably benign Het
Cdc40 C T 10: 40,843,123 D337N probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cul9 CCT CCTACT 17: 46,500,854 probably null Het
Defb22 GCTGGCCTTTGC GCTGGCCTTTGCCGCAGACCTGGCCTTTGC 2: 152,485,823 probably benign Het
Dmkn GGGGTGGAAG GGGGTGGAAGGGGTGGAAGTGGTGGAAGGGGTGGAAG 7: 30,767,173 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAATCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Flywch1 GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT 17: 23,762,177 probably null Het
Gabre CTCCGG CTCCGGATCCGG X: 72,270,049 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,758 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Il2 GG GGGCTTGAAGTGCG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTACTTTTCATTTTCCTTTT 9: 106,570,613 probably null Het
Kmt2c TG TGTTGCAG 5: 25,315,775 probably benign Het
Lce1m CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC 3: 93,018,141 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,829 probably benign Het
Med12l AGC AGCTGC 3: 59,275,985 probably benign Het
Med12l GC GCACC 3: 59,275,995 probably benign Het
Nefh CCTCACCTGGGG CCTCACCTGGGGCCTTGGGCTCACCTGGGG 11: 4,941,039 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Nusap1 GTGAGGAGCAAGCTGA GTGAGGAGCAAGCTGAAATACACGTTAGCAATGAGGAGCAAGCTGA 2: 119,627,593 probably benign Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTCGTGGTGGT 7: 127,785,332 probably benign Het
Sfr1 ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCCCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC 19: 47,732,868 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 AGC AGCCCCTGC 19: 26,631,021 probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGCGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tcof1 CCCCTTG CCCCTTGACTGCTGAGATGGGCACTTTCCCAGAGATGCCCTTG 18: 60,833,576 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Unc13b AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG AGCCAGAGCCAGAGCCAGGGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG 4: 43,177,338 probably benign Het
Usp19 GTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGT 9: 108,493,988 unknown Het
Other mutations in Kif12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Kif12 APN 4 63165884 missense probably damaging 0.99
IGL01377:Kif12 APN 4 63170725 missense probably damaging 1.00
IGL02232:Kif12 APN 4 63166495 missense probably benign 0.00
IGL02671:Kif12 APN 4 63170457 missense probably benign 0.05
IGL02719:Kif12 APN 4 63167796 missense probably benign
IGL03056:Kif12 APN 4 63166956 missense probably null 0.00
ANU05:Kif12 UTSW 4 63171423 small insertion probably benign
ANU23:Kif12 UTSW 4 63165884 missense probably damaging 0.99
ANU74:Kif12 UTSW 4 63171423 small insertion probably benign
ANU74:Kif12 UTSW 4 63171426 frame shift probably null
IGL02984:Kif12 UTSW 4 63171423 small insertion probably benign
R0401:Kif12 UTSW 4 63169525 splice site probably benign
R0927:Kif12 UTSW 4 63168773 missense possibly damaging 0.71
R1589:Kif12 UTSW 4 63166500 missense probably benign 0.00
R2178:Kif12 UTSW 4 63166959 missense probably benign 0.00
R2263:Kif12 UTSW 4 63169521 missense probably benign 0.00
R2372:Kif12 UTSW 4 63168559 missense possibly damaging 0.64
R2404:Kif12 UTSW 4 63170553 missense probably damaging 1.00
R3903:Kif12 UTSW 4 63167976 missense possibly damaging 0.73
R4126:Kif12 UTSW 4 63166437 missense probably benign 0.00
R4271:Kif12 UTSW 4 63170746 missense probably benign 0.39
R4386:Kif12 UTSW 4 63171218 missense probably damaging 1.00
R4750:Kif12 UTSW 4 63167783 missense probably damaging 0.99
R4945:Kif12 UTSW 4 63168493 critical splice donor site probably null
R5177:Kif12 UTSW 4 63167904 missense probably benign 0.13
R5421:Kif12 UTSW 4 63171428 missense probably benign 0.40
R5644:Kif12 UTSW 4 63165893 missense possibly damaging 0.75
R5757:Kif12 UTSW 4 63170518 missense probably damaging 1.00
R5772:Kif12 UTSW 4 63165941 missense probably damaging 1.00
R5858:Kif12 UTSW 4 63166410 missense probably benign 0.04
R5929:Kif12 UTSW 4 63168517 missense probably damaging 0.96
R6648:Kif12 UTSW 4 63171317 critical splice donor site probably null
R7007:Kif12 UTSW 4 63166480 missense probably benign
R7108:Kif12 UTSW 4 63171205 missense probably benign 0.15
R7171:Kif12 UTSW 4 63168694 missense probably damaging 1.00
R7852:Kif12 UTSW 4 63167989 missense probably benign 0.13
R8532:Kif12 UTSW 4 63169419 nonsense probably null
R9022:Kif12 UTSW 4 63171884 missense possibly damaging 0.57
R9029:Kif12 UTSW 4 63169467 missense probably damaging 1.00
R9052:Kif12 UTSW 4 63171831 missense probably damaging 1.00
RF011:Kif12 UTSW 4 63171427 small insertion probably benign
RF031:Kif12 UTSW 4 63171425 small insertion probably benign
RF036:Kif12 UTSW 4 63171427 small insertion probably benign
RF039:Kif12 UTSW 4 63171425 small insertion probably benign
T0975:Kif12 UTSW 4 63171423 small insertion probably benign
Z1088:Kif12 UTSW 4 63171423 small insertion probably benign
Z1176:Kif12 UTSW 4 63171423 small insertion probably benign
Z1176:Kif12 UTSW 4 63171997 missense possibly damaging 0.95
Z1177:Kif12 UTSW 4 63171423 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCTGGCCAAACGTGAAGAC -3'
(R):5'- ATGCGTCCAACTGGAGCAAC -3'

Sequencing Primer
(F):5'- GCCAAACGTGAAGACCGTGC -3'
(R):5'- CAACCTTGCTTTAGGACCCC -3'
Posted On 2019-12-04