Incidental Mutation 'RF041:5430401F13Rik'
Institutional Source Beutler Lab
Gene Symbol 5430401F13Rik
Ensembl Gene ENSMUSG00000094113
Gene NameRIKEN cDNA 5430401F13 gene
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #RF041 (G1)
Quality Score185.468
Status Not validated
Chromosomal Location131486400-131553763 bp(+) (GRCm38)
Type of Mutationsmall insertion (9 aa in frame mutation)
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075020] [ENSMUST00000161385]
AlphaFold E9Q328
Predicted Effect probably benign
Transcript: ENSMUST00000075020
SMART Domains Protein: ENSMUSP00000074539
Gene: ENSMUSG00000094113

signal peptide 1 21 N/A INTRINSIC
low complexity region 100 116 N/A INTRINSIC
low complexity region 118 166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161385
SMART Domains Protein: ENSMUSP00000125129
Gene: ENSMUSG00000094113

signal peptide 1 21 N/A INTRINSIC
low complexity region 100 116 N/A INTRINSIC
low complexity region 118 166 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik TGAGGA TGA 12: 72,881,276 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GGCTGC GGCTGCGGCATCCTGTGCTGC 4: 155,905,100 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,229 probably benign Het
Arid1b CGG CGGTGG 17: 4,995,595 probably benign Het
AY761185 CACTGTGGG C 8: 20,943,912 probably null Het
Btnl1 C T 17: 34,381,368 T246M probably benign Het
Cdc40 C T 10: 40,843,123 D337N probably damaging Het
Cul9 CCT CCTACT 17: 46,500,854 probably null Het
Flywch1 GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT 17: 23,762,177 probably null Het
Gabre CTCCGG CTCCGGATCCGG X: 72,270,049 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,758 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Il2 GG GGGCTTGAAGTGCG 3: 37,125,842 probably benign Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
Kmt2c TG TGTTGCAG 5: 25,315,775 probably benign Het
Lce1m CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC 3: 93,018,141 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,829 probably benign Het
Med12l AGC AGCTGC 3: 59,275,985 probably benign Het
Med12l GC GCACC 3: 59,275,995 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTCGTGGTGGT 7: 127,785,332 probably benign Het
Smarca2 AGC AGCCCCTGC 19: 26,631,021 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Other mutations in 5430401F13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02737:5430401F13Rik APN 6 131552592 missense probably benign 0.14
R0866:5430401F13Rik UTSW 6 131552779 missense unknown
R1674:5430401F13Rik UTSW 6 131552803 missense unknown
R6374:5430401F13Rik UTSW 6 131552929 missense unknown
R6671:5430401F13Rik UTSW 6 131551350 critical splice donor site probably null
R7150:5430401F13Rik UTSW 6 131552667 missense probably benign 0.16
RF005:5430401F13Rik UTSW 6 131552884 small insertion probably benign
RF014:5430401F13Rik UTSW 6 131552857 small insertion probably benign
RF015:5430401F13Rik UTSW 6 131552856 small insertion probably benign
RF015:5430401F13Rik UTSW 6 131552859 small insertion probably benign
RF015:5430401F13Rik UTSW 6 131552861 small insertion probably benign
RF023:5430401F13Rik UTSW 6 131552855 small insertion probably benign
RF023:5430401F13Rik UTSW 6 131552878 small insertion probably benign
RF029:5430401F13Rik UTSW 6 131552895 small insertion probably benign
RF037:5430401F13Rik UTSW 6 131552887 small insertion probably benign
RF037:5430401F13Rik UTSW 6 131552888 small insertion probably benign
RF041:5430401F13Rik UTSW 6 131552873 small insertion probably benign
RF041:5430401F13Rik UTSW 6 131552894 small insertion probably benign
RF042:5430401F13Rik UTSW 6 131552886 small insertion probably benign
RF058:5430401F13Rik UTSW 6 131552887 small insertion probably benign
RF058:5430401F13Rik UTSW 6 131552901 small insertion probably benign
RF063:5430401F13Rik UTSW 6 131552883 small insertion probably benign
RF063:5430401F13Rik UTSW 6 131552884 small insertion probably benign
X0062:5430401F13Rik UTSW 6 131552638 missense probably benign 0.29
Z1177:5430401F13Rik UTSW 6 131552721 missense possibly damaging 0.66
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04