Incidental Mutation 'RF041:Dmkn'
ID 604820
Institutional Source Beutler Lab
Gene Symbol Dmkn
Ensembl Gene ENSMUSG00000060962
Gene Name dermokine
Synonyms sk30, 1110014F24Rik, sk89, Dmkn, cI-36, dermokine
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # RF041 (G1)
Quality Score 217.468
Status Not validated
Chromosome 7
Chromosomal Location 30763756-30781063 bp(+) (GRCm38)
Type of Mutation small insertion (9 aa in frame mutation)
DNA Base Change (assembly) GGGGTGGAAG to GGGGTGGAAGGGGTGGAAGTGGTGGAAGGGGTGGAAG at 30767173 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054427] [ENSMUST00000085688] [ENSMUST00000085691] [ENSMUST00000165887] [ENSMUST00000188578]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000054427
SMART Domains Protein: ENSMUSP00000060362
Gene: ENSMUSG00000060962

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_3 22 50 5.96e-5 PROSPERO
internal_repeat_2 25 53 3.87e-5 PROSPERO
internal_repeat_2 45 73 3.87e-5 PROSPERO
internal_repeat_3 65 94 5.96e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 290 N/A INTRINSIC
low complexity region 312 331 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
internal_repeat_1 387 414 3.28e-7 PROSPERO
internal_repeat_1 422 449 3.28e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000085688
SMART Domains Protein: ENSMUSP00000082831
Gene: ENSMUSG00000060962

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_3 22 50 6.61e-5 PROSPERO
internal_repeat_2 25 53 4.31e-5 PROSPERO
internal_repeat_2 45 73 4.31e-5 PROSPERO
internal_repeat_3 65 94 6.61e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 308 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
internal_repeat_1 363 390 3.84e-7 PROSPERO
internal_repeat_1 398 425 3.84e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000085691
SMART Domains Protein: ENSMUSP00000082834
Gene: ENSMUSG00000060962

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_3 22 50 6.12e-5 PROSPERO
internal_repeat_2 25 53 3.97e-5 PROSPERO
internal_repeat_2 45 73 3.97e-5 PROSPERO
internal_repeat_3 65 94 6.12e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 290 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 338 350 N/A INTRINSIC
internal_repeat_1 378 405 3.43e-7 PROSPERO
internal_repeat_1 413 440 3.43e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000165887
SMART Domains Protein: ENSMUSP00000129031
Gene: ENSMUSG00000060962

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_2 25 53 9.56e-5 PROSPERO
internal_repeat_2 45 73 9.56e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 290 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
internal_repeat_1 394 421 1.01e-6 PROSPERO
internal_repeat_1 429 456 1.01e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000188578
SMART Domains Protein: ENSMUSP00000140196
Gene: ENSMUSG00000060962

DomainStartEndE-ValueType
low complexity region 5 102 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
internal_repeat_1 173 200 3.77e-7 PROSPERO
internal_repeat_1 208 235 3.77e-7 PROSPERO
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik TGAGGA TGA 12: 72,881,276 probably benign Het
5430401F13Rik CCAGCAAAAACAGAAAGGAAAAGG CCAGCAAAAACAGAAAGGAAAAGGAGGCCAGCAAAAACAGAAAGGAAAAGG 6: 131,552,873 probably benign Het
5430401F13Rik AAAGGTGGC AAAGGTGGCAAGCAAAAACAGAAAGGAGAAGGTGGC 6: 131,552,892 probably benign Het
5430401F13Rik AGGTGGCCAG AGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,894 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GGCTGC GGCTGCGGCATCCTGTGCTGC 4: 155,905,100 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,229 probably benign Het
Arid1b CGG CGGTGG 17: 4,995,595 probably benign Het
AY761185 CACTGTGGG C 8: 20,943,912 probably null Het
Btnl1 C T 17: 34,381,368 T246M probably benign Het
Cdc40 C T 10: 40,843,123 D337N probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cul9 CCT CCTACT 17: 46,500,854 probably null Het
Defb22 GCTGGCCTTTGC GCTGGCCTTTGCCGCAGACCTGGCCTTTGC 2: 152,485,823 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAATCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Flywch1 GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT 17: 23,762,177 probably null Het
Gabre CTCCGG CTCCGGATCCGG X: 72,270,049 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,758 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Il2 GG GGGCTTGAAGTGCG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTACTTTTCATTTTCCTTTT 9: 106,570,613 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
Kmt2c TG TGTTGCAG 5: 25,315,775 probably benign Het
Lce1m CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC 3: 93,018,141 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,829 probably benign Het
Med12l AGC AGCTGC 3: 59,275,985 probably benign Het
Med12l GC GCACC 3: 59,275,995 probably benign Het
Nefh CCTCACCTGGGG CCTCACCTGGGGCCTTGGGCTCACCTGGGG 11: 4,941,039 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Nusap1 GTGAGGAGCAAGCTGA GTGAGGAGCAAGCTGAAATACACGTTAGCAATGAGGAGCAAGCTGA 2: 119,627,593 probably benign Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTCGTGGTGGT 7: 127,785,332 probably benign Het
Sfr1 ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCCCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC 19: 47,732,868 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 AGC AGCCCCTGC 19: 26,631,021 probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGCGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tcof1 CCCCTTG CCCCTTGACTGCTGAGATGGGCACTTTCCCAGAGATGCCCTTG 18: 60,833,576 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Unc13b AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG AGCCAGAGCCAGAGCCAGGGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG 4: 43,177,338 probably benign Het
Usp19 GTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGT 9: 108,493,988 unknown Het
Other mutations in Dmkn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Dmkn APN 7 30778270 critical splice donor site probably null
IGL03084:Dmkn APN 7 30771056 missense possibly damaging 0.82
IGL03376:Dmkn APN 7 30771242 missense possibly damaging 0.92
R0077:Dmkn UTSW 7 30765294 missense probably benign 0.00
R0718:Dmkn UTSW 7 30764786 unclassified probably benign
R0892:Dmkn UTSW 7 30767404 missense probably damaging 1.00
R1163:Dmkn UTSW 7 30765051 missense probably damaging 1.00
R1858:Dmkn UTSW 7 30764565 missense probably benign 0.08
R2915:Dmkn UTSW 7 30765316 missense unknown
R4705:Dmkn UTSW 7 30763981 missense probably damaging 1.00
R4806:Dmkn UTSW 7 30771242 missense possibly damaging 0.92
R4921:Dmkn UTSW 7 30771233 missense probably damaging 0.99
R5031:Dmkn UTSW 7 30764236 missense probably benign 0.09
R5056:Dmkn UTSW 7 30764104 missense probably damaging 1.00
R5577:Dmkn UTSW 7 30764546 missense probably damaging 1.00
R5780:Dmkn UTSW 7 30777615 missense probably damaging 1.00
R6233:Dmkn UTSW 7 30779679 missense probably damaging 0.99
R6504:Dmkn UTSW 7 30776429 missense possibly damaging 0.82
R7383:Dmkn UTSW 7 30765368 missense unknown
R7526:Dmkn UTSW 7 30777651 missense possibly damaging 0.90
R7667:Dmkn UTSW 7 30777609 missense probably damaging 1.00
R8790:Dmkn UTSW 7 30764024 missense probably benign 0.33
RF007:Dmkn UTSW 7 30769704 splice site probably null
RF022:Dmkn UTSW 7 30767175 small insertion probably benign
RF027:Dmkn UTSW 7 30767194 small insertion probably benign
RF030:Dmkn UTSW 7 30767182 small insertion probably benign
RF032:Dmkn UTSW 7 30767182 small insertion probably benign
RF038:Dmkn UTSW 7 30767194 small insertion probably benign
RF054:Dmkn UTSW 7 30767188 small insertion probably benign
RF055:Dmkn UTSW 7 30767191 small insertion probably benign
RF056:Dmkn UTSW 7 30767207 small insertion probably benign
RF057:Dmkn UTSW 7 30767188 small insertion probably benign
RF062:Dmkn UTSW 7 30767175 small insertion probably benign
X0067:Dmkn UTSW 7 30778227 missense possibly damaging 0.86
Z1176:Dmkn UTSW 7 30776497 missense possibly damaging 0.82
Z1186:Dmkn UTSW 7 30765393 small deletion probably benign
Z1186:Dmkn UTSW 7 30765401 small deletion probably benign
Z1186:Dmkn UTSW 7 30767171 small insertion probably benign
Z1186:Dmkn UTSW 7 30767174 small insertion probably benign
Z1186:Dmkn UTSW 7 30767177 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTATTTTCAAAGCCTGGGCCAG -3'
(R):5'- ATCATTCCCTGGGTTGTTACAC -3'

Sequencing Primer
(F):5'- GGCCTGGCCTTCTATTGCTG -3'
(R):5'- CATTCCCTGGGTTGTTACACTGTAG -3'
Posted On 2019-12-04