Incidental Mutation 'RF041:Setd1a'
ID604821
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene NameSET domain containing 1A
SynonymsKMT2F
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF041 (G1)
Quality Score217.468
Status Not validated
Chromosome7
Chromosomal Location127776670-127800122 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GGTGGTGGT to GGTGGTGGTCGTGGTGGT at 127785332 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000126761] [ENSMUST00000144406] [ENSMUST00000154987]
Predicted Effect probably benign
Transcript: ENSMUST00000047075
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047157
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126761
SMART Domains Protein: ENSMUSP00000120666
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144406
SMART Domains Protein: ENSMUSP00000115248
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154987
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik TGAGGA TGA 12: 72,881,276 probably benign Het
5430401F13Rik CCAGCAAAAACAGAAAGGAAAAGG CCAGCAAAAACAGAAAGGAAAAGGAGGCCAGCAAAAACAGAAAGGAAAAGG 6: 131,552,873 probably benign Het
5430401F13Rik AAAGGTGGC AAAGGTGGCAAGCAAAAACAGAAAGGAGAAGGTGGC 6: 131,552,892 probably benign Het
5430401F13Rik AGGTGGCCAG AGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,894 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GGCTGC GGCTGCGGCATCCTGTGCTGC 4: 155,905,100 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,229 probably benign Het
Arid1b CGG CGGTGG 17: 4,995,595 probably benign Het
AY761185 CACTGTGGG C 8: 20,943,912 probably null Het
Btnl1 C T 17: 34,381,368 T246M probably benign Het
Cdc40 C T 10: 40,843,123 D337N probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cul9 CCT CCTACT 17: 46,500,854 probably null Het
Defb22 GCTGGCCTTTGC GCTGGCCTTTGCCGCAGACCTGGCCTTTGC 2: 152,485,823 probably benign Het
Dmkn GGGGTGGAAG GGGGTGGAAGGGGTGGAAGTGGTGGAAGGGGTGGAAG 7: 30,767,173 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAATCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Flywch1 GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT 17: 23,762,177 probably null Het
Gabre CTCCGG CTCCGGATCCGG X: 72,270,049 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,758 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Il2 GG GGGCTTGAAGTGCG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTACTTTTCATTTTCCTTTT 9: 106,570,613 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
Kmt2c TG TGTTGCAG 5: 25,315,775 probably benign Het
Lce1m CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC 3: 93,018,141 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,829 probably benign Het
Med12l AGC AGCTGC 3: 59,275,985 probably benign Het
Med12l GC GCACC 3: 59,275,995 probably benign Het
Nefh CCTCACCTGGGG CCTCACCTGGGGCCTTGGGCTCACCTGGGG 11: 4,941,039 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Nusap1 GTGAGGAGCAAGCTGA GTGAGGAGCAAGCTGAAATACACGTTAGCAATGAGGAGCAAGCTGA 2: 119,627,593 probably benign Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Sfr1 ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCCCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC 19: 47,732,868 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 AGC AGCCCCTGC 19: 26,631,021 probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGCGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tcof1 CCCCTTG CCCCTTGACTGCTGAGATGGGCACTTTCCCAGAGATGCCCTTG 18: 60,833,576 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Unc13b AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG AGCCAGAGCCAGAGCCAGGGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG 4: 43,177,338 probably benign Het
Usp19 GTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGT 9: 108,493,988 unknown Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127797698 unclassified probably benign
IGL02657:Setd1a APN 7 127795825 unclassified probably benign
IGL02792:Setd1a APN 7 127791350 missense unknown
IGL02876:Setd1a APN 7 127778501 splice site probably benign
IGL02967:Setd1a APN 7 127785177 unclassified probably benign
IGL03090:Setd1a APN 7 127786500 missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127785546 missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127785326 unclassified probably benign
FR4548:Setd1a UTSW 7 127785307 unclassified probably benign
FR4548:Setd1a UTSW 7 127785313 unclassified probably benign
FR4589:Setd1a UTSW 7 127785297 unclassified probably benign
FR4737:Setd1a UTSW 7 127785312 unclassified probably benign
FR4976:Setd1a UTSW 7 127785307 unclassified probably benign
FR4976:Setd1a UTSW 7 127785316 unclassified probably benign
R0367:Setd1a UTSW 7 127788186 splice site probably benign
R0411:Setd1a UTSW 7 127796051 unclassified probably benign
R0416:Setd1a UTSW 7 127785297 unclassified probably benign
R0470:Setd1a UTSW 7 127785057 unclassified probably benign
R0645:Setd1a UTSW 7 127787210 missense probably damaging 0.96
R0667:Setd1a UTSW 7 127786593 missense probably damaging 0.99
R1251:Setd1a UTSW 7 127797424 unclassified probably benign
R1465:Setd1a UTSW 7 127788340 unclassified probably benign
R1465:Setd1a UTSW 7 127788340 unclassified probably benign
R1660:Setd1a UTSW 7 127796669 unclassified probably benign
R1730:Setd1a UTSW 7 127785124 nonsense probably null
R1760:Setd1a UTSW 7 127785890 missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127785124 nonsense probably null
R2149:Setd1a UTSW 7 127786518 missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127785489 missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127799155 unclassified probably benign
R2679:Setd1a UTSW 7 127795724 unclassified probably benign
R3428:Setd1a UTSW 7 127785321 unclassified probably benign
R4108:Setd1a UTSW 7 127799202 unclassified probably benign
R4227:Setd1a UTSW 7 127796647 unclassified probably benign
R4438:Setd1a UTSW 7 127785731 missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127797330 unclassified probably benign
R4869:Setd1a UTSW 7 127797604 unclassified probably benign
R4892:Setd1a UTSW 7 127778524 missense probably damaging 0.99
R5152:Setd1a UTSW 7 127784025 missense probably benign
R5502:Setd1a UTSW 7 127797248 critical splice donor site probably null
R5527:Setd1a UTSW 7 127785629 missense probably damaging 0.99
R6189:Setd1a UTSW 7 127778283 splice site probably null
R6250:Setd1a UTSW 7 127791299 missense unknown
R7131:Setd1a UTSW 7 127796418 small deletion probably benign
R8029:Setd1a UTSW 7 127786214 missense probably benign 0.08
R8079:Setd1a UTSW 7 127785053 missense unknown
R8171:Setd1a UTSW 7 127791227 missense unknown
R8175:Setd1a UTSW 7 127796243 missense unknown
R8286:Setd1a UTSW 7 127786184 missense possibly damaging 0.96
RF001:Setd1a UTSW 7 127785314 unclassified probably benign
RF008:Setd1a UTSW 7 127785314 unclassified probably benign
RF011:Setd1a UTSW 7 127785343 unclassified probably benign
RF014:Setd1a UTSW 7 127785346 unclassified probably benign
RF030:Setd1a UTSW 7 127785301 unclassified probably benign
RF030:Setd1a UTSW 7 127785311 unclassified probably benign
RF031:Setd1a UTSW 7 127785311 unclassified probably benign
RF036:Setd1a UTSW 7 127785300 unclassified probably benign
RF052:Setd1a UTSW 7 127785357 unclassified probably benign
RF055:Setd1a UTSW 7 127785299 unclassified probably benign
RF056:Setd1a UTSW 7 127785303 unclassified probably benign
RF056:Setd1a UTSW 7 127785328 unclassified probably benign
RF058:Setd1a UTSW 7 127785318 unclassified probably benign
Z1176:Setd1a UTSW 7 127799094 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTACCAGCGCCATACTTCC -3'
(R):5'- TTCAGCAGCATTTCAATACGG -3'

Sequencing Primer
(F):5'- GCAACTAGAGAGGACCCTTCTG -3'
(R):5'- GGAATCCAAACTGCTGTGCTG -3'
Posted On2019-12-04