Incidental Mutation 'RF041:Cmtm1'
ID 604823
Institutional Source Beutler Lab
Gene Symbol Cmtm1
Ensembl Gene ENSMUSG00000110430
Gene Name CKLF-like MARVEL transmembrane domain containing 1
Synonyms Cklfsf1, CHLFH1a, CKLFH1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock # RF041 (G1)
Quality Score 129.457
Status Not validated
Chromosome 8
Chromosomal Location 104292622-104310145 bp(-) (GRCm38)
Type of Mutation small deletion (11 aa in frame mutation)
DNA Base Change (assembly) CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT at 104309470 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159039] [ENSMUST00000160596] [ENSMUST00000162616] [ENSMUST00000164175]
AlphaFold B7ZP21
Predicted Effect probably benign
Transcript: ENSMUST00000159039
SMART Domains Protein: ENSMUSP00000124855
Gene: ENSMUSG00000110430

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 7.45e-12 PROSPERO
internal_repeat_2 34 74 9.92e-7 PROSPERO
internal_repeat_1 66 103 7.45e-12 PROSPERO
internal_repeat_2 122 162 9.92e-7 PROSPERO
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 253 275 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160596
SMART Domains Protein: ENSMUSP00000124656
Gene: ENSMUSG00000110430

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 1.42e-11 PROSPERO
internal_repeat_2 34 74 1.79e-6 PROSPERO
internal_repeat_1 66 103 1.42e-11 PROSPERO
internal_repeat_2 122 162 1.79e-6 PROSPERO
transmembrane domain 262 284 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
transmembrane domain 315 334 N/A INTRINSIC
transmembrane domain 341 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162616
SMART Domains Protein: ENSMUSP00000124800
Gene: ENSMUSG00000031876

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 1.42e-11 PROSPERO
internal_repeat_2 34 74 1.79e-6 PROSPERO
internal_repeat_1 66 103 1.42e-11 PROSPERO
internal_repeat_2 122 162 1.79e-6 PROSPERO
transmembrane domain 262 284 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
transmembrane domain 315 334 N/A INTRINSIC
transmembrane domain 341 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164175
SMART Domains Protein: ENSMUSP00000132828
Gene: ENSMUSG00000110430

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 34 71 1.23e-5 PROSPERO
internal_repeat_1 100 137 1.23e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212847
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik TGAGGA TGA 12: 72,881,276 probably benign Het
5430401F13Rik CCAGCAAAAACAGAAAGGAAAAGG CCAGCAAAAACAGAAAGGAAAAGGAGGCCAGCAAAAACAGAAAGGAAAAGG 6: 131,552,873 probably benign Het
5430401F13Rik AAAGGTGGC AAAGGTGGCAAGCAAAAACAGAAAGGAGAAGGTGGC 6: 131,552,892 probably benign Het
5430401F13Rik AGGTGGCCAG AGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,894 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GGCTGC GGCTGCGGCATCCTGTGCTGC 4: 155,905,100 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,229 probably benign Het
Arid1b CGG CGGTGG 17: 4,995,595 probably benign Het
AY761185 CACTGTGGG C 8: 20,943,912 probably null Het
Btnl1 C T 17: 34,381,368 T246M probably benign Het
Cdc40 C T 10: 40,843,123 D337N probably damaging Het
Cul9 CCT CCTACT 17: 46,500,854 probably null Het
Defb22 GCTGGCCTTTGC GCTGGCCTTTGCCGCAGACCTGGCCTTTGC 2: 152,485,823 probably benign Het
Dmkn GGGGTGGAAG GGGGTGGAAGGGGTGGAAGTGGTGGAAGGGGTGGAAG 7: 30,767,173 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAATCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Flywch1 GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT 17: 23,762,177 probably null Het
Gabre CTCCGG CTCCGGATCCGG X: 72,270,049 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,758 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Il2 GG GGGCTTGAAGTGCG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTACTTTTCATTTTCCTTTT 9: 106,570,613 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
Kmt2c TG TGTTGCAG 5: 25,315,775 probably benign Het
Lce1m CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC 3: 93,018,141 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,829 probably benign Het
Med12l AGC AGCTGC 3: 59,275,985 probably benign Het
Med12l GC GCACC 3: 59,275,995 probably benign Het
Nefh CCTCACCTGGGG CCTCACCTGGGGCCTTGGGCTCACCTGGGG 11: 4,941,039 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Nusap1 GTGAGGAGCAAGCTGA GTGAGGAGCAAGCTGAAATACACGTTAGCAATGAGGAGCAAGCTGA 2: 119,627,593 probably benign Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTCGTGGTGGT 7: 127,785,332 probably benign Het
Sfr1 ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCCCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC 19: 47,732,868 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 AGC AGCCCCTGC 19: 26,631,021 probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGCGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tcof1 CCCCTTG CCCCTTGACTGCTGAGATGGGCACTTTCCCAGAGATGCCCTTG 18: 60,833,576 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Unc13b AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG AGCCAGAGCCAGAGCCAGGGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG 4: 43,177,338 probably benign Het
Usp19 GTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGT 9: 108,493,988 unknown Het
Other mutations in Cmtm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
Senilicus UTSW 8 104309295 missense possibly damaging 0.90
G1citation:Cmtm1 UTSW 8 104309702 frame shift probably null
R2900:Cmtm1 UTSW 8 104309544 missense possibly damaging 0.95
R4132:Cmtm1 UTSW 8 104309470 small deletion probably benign
R4615:Cmtm1 UTSW 8 104309470 small deletion probably benign
R4723:Cmtm1 UTSW 8 104293675 missense probably damaging 0.96
R5277:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5347:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5364:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5394:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5403:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5611:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5715:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5731:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5773:Cmtm1 UTSW 8 104305176 missense probably damaging 1.00
R6017:Cmtm1 UTSW 8 104310951 unclassified probably benign
R6207:Cmtm1 UTSW 8 104309470 small deletion probably benign
R6313:Cmtm1 UTSW 8 104305163 missense possibly damaging 0.81
R6528:Cmtm1 UTSW 8 104309295 missense possibly damaging 0.90
R6817:Cmtm1 UTSW 8 104309470 small deletion probably benign
R6821:Cmtm1 UTSW 8 104309702 frame shift probably null
R6822:Cmtm1 UTSW 8 104309702 frame shift probably null
R7028:Cmtm1 UTSW 8 104309470 small deletion probably benign
R7128:Cmtm1 UTSW 8 104309470 small deletion probably benign
R7132:Cmtm1 UTSW 8 104309470 small deletion probably benign
R7816:Cmtm1 UTSW 8 104309470 small deletion probably benign
R7819:Cmtm1 UTSW 8 104309702 frame shift probably null
R7841:Cmtm1 UTSW 8 104309476 missense possibly damaging 0.55
R7963:Cmtm1 UTSW 8 104309470 small deletion probably benign
R7988:Cmtm1 UTSW 8 104310142 unclassified probably benign
R8130:Cmtm1 UTSW 8 104309456 missense unknown
R8152:Cmtm1 UTSW 8 104309941 missense possibly damaging 0.83
R8439:Cmtm1 UTSW 8 104309470 small deletion probably benign
R8459:Cmtm1 UTSW 8 104309511 missense possibly damaging 0.95
R8683:Cmtm1 UTSW 8 104309470 small deletion probably benign
R8843:Cmtm1 UTSW 8 104309702 frame shift probably null
R8860:Cmtm1 UTSW 8 104309702 frame shift probably null
R8871:Cmtm1 UTSW 8 104309702 frame shift probably null
R9093:Cmtm1 UTSW 8 104309702 frame shift probably null
R9098:Cmtm1 UTSW 8 104309702 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCAACATCCCATTGGCTGAGC -3'
(R):5'- TATACCATCCAGGCAGCGAC -3'

Sequencing Primer
(F):5'- TGCCAGAAGCTATCTCTGAATC -3'
(R):5'- GGCAGCGACCTTCAGTACAAG -3'
Posted On 2019-12-04