Incidental Mutation 'RF041:Usp19'
ID 604825
Institutional Source Beutler Lab
Gene Symbol Usp19
Ensembl Gene ENSMUSG00000006676
Gene Name ubiquitin specific peptidase 19
Synonyms 8430421I07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock # RF041 (G1)
Quality Score 217.472
Status Not validated
Chromosome 9
Chromosomal Location 108490602-108502337 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000006854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006854]
AlphaFold Q3UJD6
Predicted Effect unknown
Transcript: ENSMUST00000006854
SMART Domains Protein: ENSMUSP00000006854
Gene: ENSMUSG00000006676

Pfam:CS 55 129 1.3e-6 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 7.1e-19 PFAM
Pfam:USP19_linker 415 537 2.2e-61 PFAM
Pfam:UCH 538 1253 1.2e-77 PFAM
Pfam:UCH_1 539 874 8.6e-11 PFAM
Pfam:zf-MYND 833 875 9.9e-11 PFAM
Pfam:UCH_1 1021 1235 7.1e-10 PFAM
low complexity region 1278 1287 N/A INTRINSIC
low complexity region 1301 1312 N/A INTRINSIC
transmembrane domain 1333 1355 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased body weight, reduced male fertility, and increased resistance to skeletal muscle atrophy induced by both glucocorticoids and denervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik TGAGGA TGA 12: 72,881,276 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GGCTGC GGCTGCGGCATCCTGTGCTGC 4: 155,905,100 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,229 probably benign Het
Arid1b CGG CGGTGG 17: 4,995,595 probably benign Het
AY761185 CACTGTGGG C 8: 20,943,912 probably null Het
Btnl1 C T 17: 34,381,368 T246M probably benign Het
Cdc40 C T 10: 40,843,123 D337N probably damaging Het
Cul9 CCT CCTACT 17: 46,500,854 probably null Het
Flywch1 GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT 17: 23,762,177 probably null Het
Gabre CTCCGG CTCCGGATCCGG X: 72,270,049 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,758 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Il2 GG GGGCTTGAAGTGCG 3: 37,125,842 probably benign Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
Kmt2c TG TGTTGCAG 5: 25,315,775 probably benign Het
Lce1m CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC 3: 93,018,141 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,829 probably benign Het
Med12l AGC AGCTGC 3: 59,275,985 probably benign Het
Med12l GC GCACC 3: 59,275,995 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTCGTGGTGGT 7: 127,785,332 probably benign Het
Smarca2 AGC AGCCCCTGC 19: 26,631,021 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Other mutations in Usp19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Usp19 APN 9 108498961 missense possibly damaging 0.79
IGL02345:Usp19 APN 9 108493858 missense probably benign
IGL03026:Usp19 APN 9 108493145 missense probably damaging 1.00
IGL03057:Usp19 APN 9 108499130 missense probably benign 0.01
IGL03073:Usp19 APN 9 108495803 unclassified probably benign
IGL03333:Usp19 APN 9 108494149 missense probably benign 0.05
PIT4504001:Usp19 UTSW 9 108492970 missense probably benign 0.00
PIT4576001:Usp19 UTSW 9 108492732 critical splice donor site probably null
R0053:Usp19 UTSW 9 108497170 splice site probably null
R0053:Usp19 UTSW 9 108497170 splice site probably null
R0138:Usp19 UTSW 9 108501315 missense possibly damaging 0.86
R0281:Usp19 UTSW 9 108498509 missense probably damaging 1.00
R0386:Usp19 UTSW 9 108499711 missense probably damaging 1.00
R0454:Usp19 UTSW 9 108494240 critical splice donor site probably null
R0506:Usp19 UTSW 9 108494487 missense probably damaging 1.00
R0542:Usp19 UTSW 9 108494385 splice site probably null
R0800:Usp19 UTSW 9 108495154 missense probably damaging 0.97
R0829:Usp19 UTSW 9 108493801 missense probably benign
R1594:Usp19 UTSW 9 108498522 missense probably damaging 1.00
R1917:Usp19 UTSW 9 108499325 nonsense probably null
R3744:Usp19 UTSW 9 108500181 missense probably damaging 1.00
R3964:Usp19 UTSW 9 108498029 missense probably damaging 1.00
R4275:Usp19 UTSW 9 108498694 missense probably damaging 1.00
R4789:Usp19 UTSW 9 108493234 missense possibly damaging 0.75
R5247:Usp19 UTSW 9 108496065 splice site probably null
R5249:Usp19 UTSW 9 108492608 start codon destroyed probably null 0.85
R5400:Usp19 UTSW 9 108500193 missense probably damaging 1.00
R5445:Usp19 UTSW 9 108497920 missense possibly damaging 0.61
R5578:Usp19 UTSW 9 108493440 missense probably benign
R5934:Usp19 UTSW 9 108492567 unclassified probably benign
R6003:Usp19 UTSW 9 108496380 missense probably damaging 1.00
R6217:Usp19 UTSW 9 108500144 missense probably damaging 1.00
R6230:Usp19 UTSW 9 108501941 missense probably damaging 0.99
R6505:Usp19 UTSW 9 108496883 missense probably damaging 1.00
R6585:Usp19 UTSW 9 108499727 missense probably damaging 0.97
R6865:Usp19 UTSW 9 108498819 nonsense probably null
R6953:Usp19 UTSW 9 108498931 missense possibly damaging 0.90
R7037:Usp19 UTSW 9 108496958 missense possibly damaging 0.52
R7046:Usp19 UTSW 9 108497135 missense possibly damaging 0.48
R7235:Usp19 UTSW 9 108494924 nonsense probably null
R7699:Usp19 UTSW 9 108496172 nonsense probably null
R7705:Usp19 UTSW 9 108501913 missense possibly damaging 0.89
R8175:Usp19 UTSW 9 108500178 missense probably damaging 1.00
R8551:Usp19 UTSW 9 108499297 missense possibly damaging 0.50
R8725:Usp19 UTSW 9 108493735 missense probably damaging 1.00
R9142:Usp19 UTSW 9 108495085 missense possibly damaging 0.79
R9143:Usp19 UTSW 9 108498199 missense probably damaging 1.00
R9421:Usp19 UTSW 9 108499593 missense probably damaging 1.00
Predicted Primers
Posted On 2019-12-04