Incidental Mutation 'RF041:Nefh'
ID604829
Institutional Source Beutler Lab
Gene Symbol Nefh
Ensembl Gene ENSMUSG00000020396
Gene Nameneurofilament, heavy polypeptide
SynonymsNF-H, NEFH, NF200
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF041 (G1)
Quality Score217.468
Status Not validated
Chromosome11
Chromosomal Location4938754-4948064 bp(-) (GRCm38)
Type of Mutationsmall insertion (6 aa in frame mutation)
DNA Base Change (assembly) CCTCACCTGGGG to CCTCACCTGGGGCCTTGGGCTCACCTGGGG at 4941039 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093369]
Predicted Effect probably benign
Transcript: ENSMUST00000093369
SMART Domains Protein: ENSMUSP00000091061
Gene: ENSMUSG00000020396

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
low complexity region 49 64 N/A INTRINSIC
Filament 94 410 1.45e-109 SMART
low complexity region 470 515 N/A INTRINSIC
Pfam:DUF1388 519 545 1.8e-14 PFAM
Pfam:DUF1388 536 562 5.8e-15 PFAM
Pfam:DUF1388 542 569 2.7e-12 PFAM
Pfam:DUF1388 578 611 9.7e-10 PFAM
Pfam:DUF1388 602 629 4.9e-14 PFAM
Pfam:DUF1388 608 635 4.7e-14 PFAM
Pfam:DUF1388 626 653 1.4e-13 PFAM
Pfam:DUF1388 632 659 2.5e-13 PFAM
Pfam:DUF1388 656 683 4.4e-14 PFAM
Pfam:DUF1388 680 706 1.5e-12 PFAM
Pfam:DUF1388 700 730 5e-12 PFAM
Pfam:DUF1388 728 755 7.9e-14 PFAM
Pfam:DUF1388 752 779 4.7e-14 PFAM
Pfam:DUF1388 779 800 1.9e-9 PFAM
low complexity region 816 829 N/A INTRINSIC
low complexity region 858 948 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
low complexity region 976 1039 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and functionally maintain neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the heavy neurofilament protein. This protein is commonly used as a biomarker of neuronal damage and susceptibility to amyotrophic lateral sclerosis (ALS) has been associated with mutations in this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased axon diameter and transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik TGAGGA TGA 12: 72,881,276 probably benign Het
5430401F13Rik CCAGCAAAAACAGAAAGGAAAAGG CCAGCAAAAACAGAAAGGAAAAGGAGGCCAGCAAAAACAGAAAGGAAAAGG 6: 131,552,873 probably benign Het
5430401F13Rik AAAGGTGGC AAAGGTGGCAAGCAAAAACAGAAAGGAGAAGGTGGC 6: 131,552,892 probably benign Het
5430401F13Rik AGGTGGCCAG AGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,894 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GGCTGC GGCTGCGGCATCCTGTGCTGC 4: 155,905,100 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,229 probably benign Het
Arid1b CGG CGGTGG 17: 4,995,595 probably benign Het
AY761185 CACTGTGGG C 8: 20,943,912 probably null Het
Btnl1 C T 17: 34,381,368 T246M probably benign Het
Cdc40 C T 10: 40,843,123 D337N probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cul9 CCT CCTACT 17: 46,500,854 probably null Het
Defb22 GCTGGCCTTTGC GCTGGCCTTTGCCGCAGACCTGGCCTTTGC 2: 152,485,823 probably benign Het
Dmkn GGGGTGGAAG GGGGTGGAAGGGGTGGAAGTGGTGGAAGGGGTGGAAG 7: 30,767,173 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAATCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Flywch1 GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT 17: 23,762,177 probably null Het
Gabre CTCCGG CTCCGGATCCGG X: 72,270,049 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,758 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Il2 GG GGGCTTGAAGTGCG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTACTTTTCATTTTCCTTTT 9: 106,570,613 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
Kmt2c TG TGTTGCAG 5: 25,315,775 probably benign Het
Lce1m CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC 3: 93,018,141 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,829 probably benign Het
Med12l AGC AGCTGC 3: 59,275,985 probably benign Het
Med12l GC GCACC 3: 59,275,995 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Nusap1 GTGAGGAGCAAGCTGA GTGAGGAGCAAGCTGAAATACACGTTAGCAATGAGGAGCAAGCTGA 2: 119,627,593 probably benign Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTCGTGGTGGT 7: 127,785,332 probably benign Het
Sfr1 ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCCCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC 19: 47,732,868 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 AGC AGCCCCTGC 19: 26,631,021 probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGCGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tcof1 CCCCTTG CCCCTTGACTGCTGAGATGGGCACTTTCCCAGAGATGCCCTTG 18: 60,833,576 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Unc13b AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG AGCCAGAGCCAGAGCCAGGGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG 4: 43,177,338 probably benign Het
Usp19 GTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGT 9: 108,493,988 unknown Het
Other mutations in Nefh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Nefh APN 11 4941356 missense possibly damaging 0.71
IGL03025:Nefh APN 11 4945289 missense probably damaging 0.99
FR4340:Nefh UTSW 11 4941033 small insertion probably benign
FR4340:Nefh UTSW 11 4941038 small insertion probably benign
FR4340:Nefh UTSW 11 4941040 small insertion probably benign
R0041:Nefh UTSW 11 4945184 missense possibly damaging 0.92
R0149:Nefh UTSW 11 4940799 missense probably benign 0.39
R0361:Nefh UTSW 11 4940799 missense probably benign 0.39
R0531:Nefh UTSW 11 4940240 missense probably damaging 1.00
R1340:Nefh UTSW 11 4941002 small insertion probably benign
R1349:Nefh UTSW 11 4941010 small insertion probably benign
R1469:Nefh UTSW 11 4940066 missense probably benign 0.20
R1469:Nefh UTSW 11 4940066 missense probably benign 0.20
R1564:Nefh UTSW 11 4939878 missense unknown
R2165:Nefh UTSW 11 4943872 missense probably damaging 1.00
R2417:Nefh UTSW 11 4939479 missense unknown
R2906:Nefh UTSW 11 4940216 missense probably benign 0.15
R3750:Nefh UTSW 11 4939937 missense probably benign 0.33
R4298:Nefh UTSW 11 4940066 missense probably benign
R4462:Nefh UTSW 11 4941015 missense probably damaging 0.98
R4713:Nefh UTSW 11 4939656 missense unknown
R4878:Nefh UTSW 11 4941333 missense probably damaging 0.98
R5423:Nefh UTSW 11 4940985 missense possibly damaging 0.59
R5648:Nefh UTSW 11 4945233 missense probably damaging 1.00
R5893:Nefh UTSW 11 4941323 missense probably damaging 1.00
R6459:Nefh UTSW 11 4939551 missense unknown
R7583:Nefh UTSW 11 4941089 missense probably damaging 0.96
RF001:Nefh UTSW 11 4941030 small insertion probably benign
RF002:Nefh UTSW 11 4941047 small insertion probably benign
RF002:Nefh UTSW 11 4941050 small insertion probably benign
RF009:Nefh UTSW 11 4940997 small insertion probably benign
RF012:Nefh UTSW 11 4941030 small insertion probably benign
RF012:Nefh UTSW 11 4941032 small insertion probably benign
RF012:Nefh UTSW 11 4941055 small insertion probably benign
RF013:Nefh UTSW 11 4941032 small insertion probably benign
RF016:Nefh UTSW 11 4941022 small insertion probably benign
RF016:Nefh UTSW 11 4941023 small insertion probably benign
RF025:Nefh UTSW 11 4941003 small insertion probably benign
RF025:Nefh UTSW 11 4941029 small insertion probably benign
RF028:Nefh UTSW 11 4941012 small insertion probably benign
RF028:Nefh UTSW 11 4941029 small insertion probably benign
RF033:Nefh UTSW 11 4941029 frame shift probably null
RF033:Nefh UTSW 11 4941039 small insertion probably benign
RF035:Nefh UTSW 11 4941039 small insertion probably benign
RF036:Nefh UTSW 11 4941010 small insertion probably benign
RF036:Nefh UTSW 11 4941016 small insertion probably benign
RF036:Nefh UTSW 11 4941036 small insertion probably benign
RF036:Nefh UTSW 11 4941048 small insertion probably benign
RF037:Nefh UTSW 11 4940999 small insertion probably benign
RF037:Nefh UTSW 11 4941046 small insertion probably benign
RF037:Nefh UTSW 11 4941054 small insertion probably benign
RF038:Nefh UTSW 11 4941012 small insertion probably benign
RF038:Nefh UTSW 11 4941018 small insertion probably benign
RF038:Nefh UTSW 11 4941019 small insertion probably benign
RF038:Nefh UTSW 11 4941027 small insertion probably benign
RF038:Nefh UTSW 11 4941029 small insertion probably benign
RF038:Nefh UTSW 11 4941040 small insertion probably benign
RF039:Nefh UTSW 11 4941007 small insertion probably benign
RF043:Nefh UTSW 11 4941016 small insertion probably benign
RF044:Nefh UTSW 11 4941016 small insertion probably benign
RF044:Nefh UTSW 11 4941021 small insertion probably benign
RF044:Nefh UTSW 11 4941023 small insertion probably benign
RF047:Nefh UTSW 11 4941038 small insertion probably benign
RF048:Nefh UTSW 11 4941003 small insertion probably benign
RF048:Nefh UTSW 11 4941007 small insertion probably benign
RF049:Nefh UTSW 11 4940997 small insertion probably benign
RF051:Nefh UTSW 11 4941054 small insertion probably benign
RF053:Nefh UTSW 11 4941014 nonsense probably null
RF054:Nefh UTSW 11 4941048 small insertion probably benign
RF055:Nefh UTSW 11 4941004 small insertion probably benign
RF058:Nefh UTSW 11 4941021 small insertion probably benign
RF060:Nefh UTSW 11 4941050 small insertion probably benign
RF060:Nefh UTSW 11 4941052 small insertion probably benign
RF062:Nefh UTSW 11 4941028 small insertion probably benign
T0975:Nefh UTSW 11 4940151 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGTAGCTGGAGACTTGGG -3'
(R):5'- ATTGGCTTTGGTCCGAGTCC -3'

Sequencing Primer
(F):5'- ACTTGGGCTCAGCTGGTGAC -3'
(R):5'- TCTTACTGAAGGACTCCCAAAAATTC -3'
Posted On2019-12-04