Incidental Mutation 'RF041:Tob1'
ID 604830
Institutional Source Beutler Lab
Gene Symbol Tob1
Ensembl Gene ENSMUSG00000037573
Gene Name transducer of ErbB-2.1
Synonyms Trob, Tob
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF041 (G1)
Quality Score 160.468
Status Not validated
Chromosome 11
Chromosomal Location 94211454-94215495 bp(+) (GRCm38)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) CACA to CACAACA at 94214451 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041589]
AlphaFold Q61471
Predicted Effect probably benign
Transcript: ENSMUST00000041589
SMART Domains Protein: ENSMUSP00000036039
Gene: ENSMUSG00000037573

btg1 1 106 2.41e-77 SMART
low complexity region 141 160 N/A INTRINSIC
low complexity region 176 187 N/A INTRINSIC
low complexity region 238 280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transducer of erbB-2 /B-cell translocation gene protein family. Members of this family are anti-proliferative factors that have the potential to regulate cell growth. The encoded protein may function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable and exhibit increased bone mass due to increased osteoblast proliferation and differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik TGAGGA TGA 12: 72,881,276 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GGCTGC GGCTGCGGCATCCTGTGCTGC 4: 155,905,100 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,229 probably benign Het
Arid1b CGG CGGTGG 17: 4,995,595 probably benign Het
AY761185 CACTGTGGG C 8: 20,943,912 probably null Het
Btnl1 C T 17: 34,381,368 T246M probably benign Het
Cdc40 C T 10: 40,843,123 D337N probably damaging Het
Cul9 CCT CCTACT 17: 46,500,854 probably null Het
Flywch1 GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT 17: 23,762,177 probably null Het
Gabre CTCCGG CTCCGGATCCGG X: 72,270,049 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,758 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Il2 GG GGGCTTGAAGTGCG 3: 37,125,842 probably benign Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
Kmt2c TG TGTTGCAG 5: 25,315,775 probably benign Het
Lce1m CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC 3: 93,018,141 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,829 probably benign Het
Med12l AGC AGCTGC 3: 59,275,985 probably benign Het
Med12l GC GCACC 3: 59,275,995 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTCGTGGTGGT 7: 127,785,332 probably benign Het
Smarca2 AGC AGCCCCTGC 19: 26,631,021 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Other mutations in Tob1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Tob1 APN 11 94214055 missense probably damaging 1.00
IGL02028:Tob1 APN 11 94214226 missense probably benign 0.43
IGL02866:Tob1 APN 11 94214057 missense possibly damaging 0.87
FR4304:Tob1 UTSW 11 94214464 small insertion probably benign
FR4304:Tob1 UTSW 11 94214477 nonsense probably null
FR4340:Tob1 UTSW 11 94214454 small insertion probably benign
FR4340:Tob1 UTSW 11 94214460 small insertion probably benign
FR4340:Tob1 UTSW 11 94214477 small insertion probably benign
FR4342:Tob1 UTSW 11 94214472 small insertion probably benign
FR4449:Tob1 UTSW 11 94214468 small insertion probably benign
FR4449:Tob1 UTSW 11 94214475 small insertion probably benign
FR4548:Tob1 UTSW 11 94214455 small insertion probably benign
FR4548:Tob1 UTSW 11 94214469 small insertion probably benign
FR4589:Tob1 UTSW 11 94214451 small insertion probably benign
FR4589:Tob1 UTSW 11 94214477 frame shift probably null
FR4737:Tob1 UTSW 11 94214451 small insertion probably benign
FR4737:Tob1 UTSW 11 94214464 small insertion probably benign
FR4737:Tob1 UTSW 11 94214478 small insertion probably benign
FR4976:Tob1 UTSW 11 94214472 small insertion probably benign
R0142:Tob1 UTSW 11 94214597 missense probably damaging 1.00
R1777:Tob1 UTSW 11 94213754 missense probably damaging 1.00
R4213:Tob1 UTSW 11 94214192 missense probably damaging 1.00
R4280:Tob1 UTSW 11 94214322 missense probably benign
R4537:Tob1 UTSW 11 94214452 small deletion probably benign
R4899:Tob1 UTSW 11 94214452 small deletion probably benign
R5074:Tob1 UTSW 11 94213741 missense possibly damaging 0.88
R5502:Tob1 UTSW 11 94214452 small deletion probably benign
R5828:Tob1 UTSW 11 94213757 missense probably damaging 1.00
R5828:Tob1 UTSW 11 94213759 nonsense probably null
R7471:Tob1 UTSW 11 94213882 missense probably benign 0.45
R7839:Tob1 UTSW 11 94213772 missense probably damaging 1.00
R8383:Tob1 UTSW 11 94214377 small deletion probably benign
R8491:Tob1 UTSW 11 94214289 missense probably benign 0.11
R9131:Tob1 UTSW 11 94214377 small deletion probably benign
RF028:Tob1 UTSW 11 94214451 small insertion probably benign
RF042:Tob1 UTSW 11 94214451 small insertion probably benign
RF044:Tob1 UTSW 11 94214461 small insertion probably benign
RF054:Tob1 UTSW 11 94214461 small insertion probably benign
Z1177:Tob1 UTSW 11 94213992 missense probably benign 0.38
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04