Incidental Mutation 'RF041:4930447C04Rik'
ID 604833
Institutional Source Beutler Lab
Gene Symbol 4930447C04Rik
Ensembl Gene ENSMUSG00000021098
Gene Name RIKEN cDNA 4930447C04 gene
Synonyms Six6as, Six6os1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock # RF041 (G1)
Quality Score 103.457
Status Not validated
Chromosome 12
Chromosomal Location 72881109-72940774 bp(-) (GRCm38)
Type of Mutation small deletion (1 aa in frame mutation)
DNA Base Change (assembly) TGAGGA to TGA at 72881276 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044000] [ENSMUST00000110489]
AlphaFold Q9CTN5
Predicted Effect probably benign
Transcript: ENSMUST00000044000
SMART Domains Protein: ENSMUSP00000035376
Gene: ENSMUSG00000021098

DomainStartEndE-ValueType
low complexity region 137 147 N/A INTRINSIC
coiled coil region 197 233 N/A INTRINSIC
low complexity region 247 261 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 522 534 N/A INTRINSIC
low complexity region 552 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110489
SMART Domains Protein: ENSMUSP00000106115
Gene: ENSMUSG00000021098

DomainStartEndE-ValueType
Pfam:S6OS1 31 575 1.1e-277 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with meiotic arrest and defective synaptic formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik CCAGCAAAAACAGAAAGGAAAAGG CCAGCAAAAACAGAAAGGAAAAGGAGGCCAGCAAAAACAGAAAGGAAAAGG 6: 131,552,873 probably benign Het
5430401F13Rik AAAGGTGGC AAAGGTGGCAAGCAAAAACAGAAAGGAGAAGGTGGC 6: 131,552,892 probably benign Het
5430401F13Rik AGGTGGCCAG AGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,894 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GGCTGC GGCTGCGGCATCCTGTGCTGC 4: 155,905,100 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,229 probably benign Het
Arid1b CGG CGGTGG 17: 4,995,595 probably benign Het
AY761185 CACTGTGGG C 8: 20,943,912 probably null Het
Btnl1 C T 17: 34,381,368 T246M probably benign Het
Cdc40 C T 10: 40,843,123 D337N probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cul9 CCT CCTACT 17: 46,500,854 probably null Het
Defb22 GCTGGCCTTTGC GCTGGCCTTTGCCGCAGACCTGGCCTTTGC 2: 152,485,823 probably benign Het
Dmkn GGGGTGGAAG GGGGTGGAAGGGGTGGAAGTGGTGGAAGGGGTGGAAG 7: 30,767,173 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAATCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Flywch1 GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT 17: 23,762,177 probably null Het
Gabre CTCCGG CTCCGGATCCGG X: 72,270,049 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,758 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Il2 GG GGGCTTGAAGTGCG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTACTTTTCATTTTCCTTTT 9: 106,570,613 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
Kmt2c TG TGTTGCAG 5: 25,315,775 probably benign Het
Lce1m CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC 3: 93,018,141 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,829 probably benign Het
Med12l AGC AGCTGC 3: 59,275,985 probably benign Het
Med12l GC GCACC 3: 59,275,995 probably benign Het
Nefh CCTCACCTGGGG CCTCACCTGGGGCCTTGGGCTCACCTGGGG 11: 4,941,039 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Nusap1 GTGAGGAGCAAGCTGA GTGAGGAGCAAGCTGAAATACACGTTAGCAATGAGGAGCAAGCTGA 2: 119,627,593 probably benign Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTCGTGGTGGT 7: 127,785,332 probably benign Het
Sfr1 ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCCCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC 19: 47,732,868 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 AGC AGCCCCTGC 19: 26,631,021 probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGCGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tcof1 CCCCTTG CCCCTTGACTGCTGAGATGGGCACTTTCCCAGAGATGCCCTTG 18: 60,833,576 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Unc13b AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG AGCCAGAGCCAGAGCCAGGGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG 4: 43,177,338 probably benign Het
Usp19 GTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGT 9: 108,493,988 unknown Het
Other mutations in 4930447C04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:4930447C04Rik APN 12 72881386 missense possibly damaging 0.71
IGL01611:4930447C04Rik APN 12 72907870 missense possibly damaging 0.93
IGL02352:4930447C04Rik APN 12 72895055 splice site probably null
IGL02359:4930447C04Rik APN 12 72895055 splice site probably null
FR4304:4930447C04Rik UTSW 12 72881287 small deletion probably benign
R0650:4930447C04Rik UTSW 12 72910056 missense probably damaging 0.99
R0651:4930447C04Rik UTSW 12 72910056 missense probably damaging 0.99
R1271:4930447C04Rik UTSW 12 72892883 missense possibly damaging 0.71
R1321:4930447C04Rik UTSW 12 72898544 splice site probably benign
R1387:4930447C04Rik UTSW 12 72915434 missense probably benign 0.04
R1424:4930447C04Rik UTSW 12 72892895 nonsense probably null
R1440:4930447C04Rik UTSW 12 72881421 missense possibly damaging 0.85
R1538:4930447C04Rik UTSW 12 72881346 missense possibly damaging 0.92
R1694:4930447C04Rik UTSW 12 72885218 splice site probably null
R1888:4930447C04Rik UTSW 12 72913256 missense unknown
R1888:4930447C04Rik UTSW 12 72913256 missense unknown
R2151:4930447C04Rik UTSW 12 72907951 splice site probably null
R4930:4930447C04Rik UTSW 12 72906234 missense possibly damaging 0.71
R4967:4930447C04Rik UTSW 12 72909728 nonsense probably null
R5243:4930447C04Rik UTSW 12 72909769 critical splice donor site probably null
R6312:4930447C04Rik UTSW 12 72889767 missense possibly damaging 0.86
R6825:4930447C04Rik UTSW 12 72907880 missense probably benign 0.32
R7275:4930447C04Rik UTSW 12 72910021 missense possibly damaging 0.71
R8427:4930447C04Rik UTSW 12 72903286 missense possibly damaging 0.86
R8669:4930447C04Rik UTSW 12 72902460 missense probably benign 0.32
R8674:4930447C04Rik UTSW 12 72909922 missense probably benign 0.00
R9065:4930447C04Rik UTSW 12 72892830 missense possibly damaging 0.86
Z1088:4930447C04Rik UTSW 12 72939395 unclassified probably benign
Z1176:4930447C04Rik UTSW 12 72916726 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GAGATTGTTTAATAGGGCCTACAAG -3'
(R):5'- CAAGGACAATGCCTTATGTGTATG -3'

Sequencing Primer
(F):5'- TTAATAGGGCCTACAAGTCAAAATC -3'
(R):5'- ATGCCTTATGTGTATGAAGAATACG -3'
Posted On 2019-12-04