Incidental Mutation 'RF041:Slc39a4'
ID 604834
Institutional Source Beutler Lab
Gene Symbol Slc39a4
Ensembl Gene ENSMUSG00000063354
Gene Name solute carrier family 39 (zinc transporter), member 4
Synonyms AWMS2, zip4, 1600025H15Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF041 (G1)
Quality Score 214.468
Status Not validated
Chromosome 15
Chromosomal Location 76612383-76617384 bp(-) (GRCm38)
Type of Mutation small insertion (12 aa in frame mutation)
DNA Base Change (assembly) TGTGGTC to TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC at 76614866 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073428] [ENSMUST00000230977]
AlphaFold Q78IQ7
Predicted Effect probably benign
Transcript: ENSMUST00000073428
SMART Domains Protein: ENSMUSP00000073134
Gene: ENSMUSG00000063354

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
Pfam:Zip 335 652 3.5e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230977
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc/iron-regulated transporter-like protein (ZIP) family. The encoded protein localizes to cell membranes and is required for zinc uptake in the intestine. Mutations in this gene result in acrodermatitis enteropathica. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic letahlity around E10. Mice heterozygous for a null allele exhibit developmental defects similar to the teratology of zinc deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik TGAGGA TGA 12: 72,881,276 probably benign Het
5430401F13Rik CCAGCAAAAACAGAAAGGAAAAGG CCAGCAAAAACAGAAAGGAAAAGGAGGCCAGCAAAAACAGAAAGGAAAAGG 6: 131,552,873 probably benign Het
5430401F13Rik AAAGGTGGC AAAGGTGGCAAGCAAAAACAGAAAGGAGAAGGTGGC 6: 131,552,892 probably benign Het
5430401F13Rik AGGTGGCCAG AGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,894 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GGCTGC GGCTGCGGCATCCTGTGCTGC 4: 155,905,100 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,229 probably benign Het
Arid1b CGG CGGTGG 17: 4,995,595 probably benign Het
AY761185 CACTGTGGG C 8: 20,943,912 probably null Het
Btnl1 C T 17: 34,381,368 T246M probably benign Het
Cdc40 C T 10: 40,843,123 D337N probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cul9 CCT CCTACT 17: 46,500,854 probably null Het
Defb22 GCTGGCCTTTGC GCTGGCCTTTGCCGCAGACCTGGCCTTTGC 2: 152,485,823 probably benign Het
Dmkn GGGGTGGAAG GGGGTGGAAGGGGTGGAAGTGGTGGAAGGGGTGGAAG 7: 30,767,173 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAATCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Flywch1 GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT 17: 23,762,177 probably null Het
Gabre CTCCGG CTCCGGATCCGG X: 72,270,049 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,758 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Il2 GG GGGCTTGAAGTGCG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTACTTTTCATTTTCCTTTT 9: 106,570,613 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
Kmt2c TG TGTTGCAG 5: 25,315,775 probably benign Het
Lce1m CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC 3: 93,018,141 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,829 probably benign Het
Med12l AGC AGCTGC 3: 59,275,985 probably benign Het
Med12l GC GCACC 3: 59,275,995 probably benign Het
Nefh CCTCACCTGGGG CCTCACCTGGGGCCTTGGGCTCACCTGGGG 11: 4,941,039 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Nusap1 GTGAGGAGCAAGCTGA GTGAGGAGCAAGCTGAAATACACGTTAGCAATGAGGAGCAAGCTGA 2: 119,627,593 probably benign Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTCGTGGTGGT 7: 127,785,332 probably benign Het
Sfr1 ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCCCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC 19: 47,732,868 probably benign Het
Smarca2 AGC AGCCCCTGC 19: 26,631,021 probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGCGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tcof1 CCCCTTG CCCCTTGACTGCTGAGATGGGCACTTTCCCAGAGATGCCCTTG 18: 60,833,576 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Unc13b AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG AGCCAGAGCCAGAGCCAGGGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG 4: 43,177,338 probably benign Het
Usp19 GTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGT 9: 108,493,988 unknown Het
Other mutations in Slc39a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02558:Slc39a4 APN 15 76614203 missense probably damaging 1.00
IGL02597:Slc39a4 APN 15 76613624 missense probably benign
IGL02798:Slc39a4 APN 15 76615182 missense probably benign 0.04
texline UTSW 15 76614083 missense probably damaging 1.00
R0519:Slc39a4 UTSW 15 76615138 missense probably benign 0.38
R0815:Slc39a4 UTSW 15 76612639 missense probably damaging 1.00
R1502:Slc39a4 UTSW 15 76616593 missense probably benign 0.00
R1547:Slc39a4 UTSW 15 76614147 nonsense probably null
R2919:Slc39a4 UTSW 15 76616670 missense probably damaging 1.00
R4634:Slc39a4 UTSW 15 76614493 missense probably benign
R5029:Slc39a4 UTSW 15 76614083 missense probably damaging 1.00
R5030:Slc39a4 UTSW 15 76614083 missense probably damaging 1.00
R5669:Slc39a4 UTSW 15 76614163 missense probably damaging 1.00
R6020:Slc39a4 UTSW 15 76616142 missense probably benign 0.03
R6741:Slc39a4 UTSW 15 76614083 missense probably damaging 1.00
R6920:Slc39a4 UTSW 15 76613270 missense probably damaging 0.99
R7072:Slc39a4 UTSW 15 76613258 missense probably damaging 1.00
R7920:Slc39a4 UTSW 15 76614085 missense probably damaging 1.00
R9217:Slc39a4 UTSW 15 76613926 missense possibly damaging 0.60
R9300:Slc39a4 UTSW 15 76614559 missense probably damaging 1.00
RF035:Slc39a4 UTSW 15 76614866 small insertion probably benign
RF039:Slc39a4 UTSW 15 76614870 small insertion probably benign
RF039:Slc39a4 UTSW 15 76614871 small insertion probably benign
RF040:Slc39a4 UTSW 15 76614866 small insertion probably benign
RF042:Slc39a4 UTSW 15 76614871 small insertion probably benign
RF043:Slc39a4 UTSW 15 76614870 small insertion probably benign
RF044:Slc39a4 UTSW 15 76614870 small insertion probably benign
Z1176:Slc39a4 UTSW 15 76614173 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGACCCATGGAAGGTTGTC -3'
(R):5'- TAGCCCTCAGTACTTTGTGGAC -3'

Sequencing Primer
(F):5'- GTCTTCTTTCTCCAGAATGGCATGAG -3'
(R):5'- CAATATCACGCTGCATGGTG -3'
Posted On 2019-12-04