Incidental Mutation 'RF041:Tfeb'
ID 604842
Institutional Source Beutler Lab
Gene Symbol Tfeb
Ensembl Gene ENSMUSG00000023990
Gene Name transcription factor EB
Synonyms bHLHe35, TFEB, Tcfeb
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF041 (G1)
Quality Score 153.468
Status Not validated
Chromosome 17
Chromosomal Location 47737030-47792419 bp(+) (GRCm38)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) GCA to GCATCA at 47786100 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024786] [ENSMUST00000086932] [ENSMUST00000113284] [ENSMUST00000113288] [ENSMUST00000125177] [ENSMUST00000126258] [ENSMUST00000130208] [ENSMUST00000137845] [ENSMUST00000141631] [ENSMUST00000146782] [ENSMUST00000159641] [ENSMUST00000160373]
AlphaFold Q9R210
Predicted Effect probably benign
Transcript: ENSMUST00000024786
SMART Domains Protein: ENSMUSP00000024786
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
Pfam:MITF_TFEB_C_3_N 63 220 2e-69 PFAM
HLH 299 352 1.44e-15 SMART
Pfam:DUF3371 379 531 1.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086932
SMART Domains Protein: ENSMUSP00000084151
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113284
SMART Domains Protein: ENSMUSP00000108909
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
Pfam:HLH 235 266 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113288
SMART Domains Protein: ENSMUSP00000108913
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125177
SMART Domains Protein: ENSMUSP00000121888
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 42 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126258
Predicted Effect probably benign
Transcript: ENSMUST00000130208
SMART Domains Protein: ENSMUSP00000122228
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137845
Predicted Effect probably benign
Transcript: ENSMUST00000141631
SMART Domains Protein: ENSMUSP00000118057
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146782
SMART Domains Protein: ENSMUSP00000120311
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
HLH 99 152 1.44e-15 SMART
Pfam:DUF3371 179 332 1.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159641
SMART Domains Protein: ENSMUSP00000124379
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160373
SMART Domains Protein: ENSMUSP00000124708
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik TGAGGA TGA 12: 72,881,276 probably benign Het
5430401F13Rik CCAGCAAAAACAGAAAGGAAAAGG CCAGCAAAAACAGAAAGGAAAAGGAGGCCAGCAAAAACAGAAAGGAAAAGG 6: 131,552,873 probably benign Het
5430401F13Rik AAAGGTGGC AAAGGTGGCAAGCAAAAACAGAAAGGAGAAGGTGGC 6: 131,552,892 probably benign Het
5430401F13Rik AGGTGGCCAG AGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,894 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GGCTGC GGCTGCGGCATCCTGTGCTGC 4: 155,905,100 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,229 probably benign Het
Arid1b CGG CGGTGG 17: 4,995,595 probably benign Het
AY761185 CACTGTGGG C 8: 20,943,912 probably null Het
Btnl1 C T 17: 34,381,368 T246M probably benign Het
Cdc40 C T 10: 40,843,123 D337N probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cul9 CCT CCTACT 17: 46,500,854 probably null Het
Defb22 GCTGGCCTTTGC GCTGGCCTTTGCCGCAGACCTGGCCTTTGC 2: 152,485,823 probably benign Het
Dmkn GGGGTGGAAG GGGGTGGAAGGGGTGGAAGTGGTGGAAGGGGTGGAAG 7: 30,767,173 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAATCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Flywch1 GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT 17: 23,762,177 probably null Het
Gabre CTCCGG CTCCGGATCCGG X: 72,270,049 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,758 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Il2 GG GGGCTTGAAGTGCG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTACTTTTCATTTTCCTTTT 9: 106,570,613 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
Kmt2c TG TGTTGCAG 5: 25,315,775 probably benign Het
Lce1m CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC 3: 93,018,141 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,829 probably benign Het
Med12l AGC AGCTGC 3: 59,275,985 probably benign Het
Med12l GC GCACC 3: 59,275,995 probably benign Het
Nefh CCTCACCTGGGG CCTCACCTGGGGCCTTGGGCTCACCTGGGG 11: 4,941,039 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Nusap1 GTGAGGAGCAAGCTGA GTGAGGAGCAAGCTGAAATACACGTTAGCAATGAGGAGCAAGCTGA 2: 119,627,593 probably benign Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTCGTGGTGGT 7: 127,785,332 probably benign Het
Sfr1 ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCCCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC 19: 47,732,868 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 AGC AGCCCCTGC 19: 26,631,021 probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGCGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tcof1 CCCCTTG CCCCTTGACTGCTGAGATGGGCACTTTCCCAGAGATGCCCTTG 18: 60,833,576 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Unc13b AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG AGCCAGAGCCAGAGCCAGGGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG 4: 43,177,338 probably benign Het
Usp19 GTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGT 9: 108,493,988 unknown Het
Other mutations in Tfeb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Tfeb APN 17 47791664 missense probably benign 0.10
IGL03248:Tfeb APN 17 47786995 missense probably benign
IGL03280:Tfeb APN 17 47785937 missense probably benign
FR4304:Tfeb UTSW 17 47786094 small insertion probably benign
FR4976:Tfeb UTSW 17 47786094 small insertion probably benign
R0414:Tfeb UTSW 17 47788299 splice site probably null
R1712:Tfeb UTSW 17 47788986 critical splice donor site probably null
R2014:Tfeb UTSW 17 47791559 missense probably damaging 0.97
R2101:Tfeb UTSW 17 47789665 missense probably damaging 1.00
R4283:Tfeb UTSW 17 47789774 missense probably damaging 1.00
R4734:Tfeb UTSW 17 47785862 missense probably benign 0.33
R4785:Tfeb UTSW 17 47788227 splice site probably null
R4948:Tfeb UTSW 17 47785979 missense probably benign 0.00
R5896:Tfeb UTSW 17 47759508 critical splice donor site probably null
R6522:Tfeb UTSW 17 47789702 missense probably damaging 1.00
R6804:Tfeb UTSW 17 47789810 critical splice donor site probably null
R6836:Tfeb UTSW 17 47786198 critical splice donor site probably null
R6923:Tfeb UTSW 17 47786983 missense probably benign 0.11
RF002:Tfeb UTSW 17 47786102 small insertion probably benign
RF003:Tfeb UTSW 17 47788078 missense possibly damaging 0.86
RF006:Tfeb UTSW 17 47786113 small insertion probably benign
RF008:Tfeb UTSW 17 47786102 small insertion probably benign
RF010:Tfeb UTSW 17 47786094 small insertion probably benign
RF010:Tfeb UTSW 17 47786107 small insertion probably benign
RF018:Tfeb UTSW 17 47786095 small insertion probably benign
RF022:Tfeb UTSW 17 47786094 small insertion probably benign
RF025:Tfeb UTSW 17 47786088 small insertion probably benign
RF028:Tfeb UTSW 17 47786097 small insertion probably benign
RF030:Tfeb UTSW 17 47786111 small insertion probably benign
RF030:Tfeb UTSW 17 47786112 small insertion probably benign
RF030:Tfeb UTSW 17 47786113 small insertion probably benign
RF034:Tfeb UTSW 17 47786097 small insertion probably benign
RF034:Tfeb UTSW 17 47786098 nonsense probably null
RF035:Tfeb UTSW 17 47786111 small insertion probably benign
RF036:Tfeb UTSW 17 47786103 small insertion probably benign
RF038:Tfeb UTSW 17 47786105 small insertion probably benign
RF038:Tfeb UTSW 17 47786112 small insertion probably benign
RF039:Tfeb UTSW 17 47786095 small insertion probably benign
RF039:Tfeb UTSW 17 47786110 nonsense probably null
RF040:Tfeb UTSW 17 47786097 small insertion probably benign
RF040:Tfeb UTSW 17 47786110 small insertion probably benign
RF040:Tfeb UTSW 17 47786111 small insertion probably benign
RF040:Tfeb UTSW 17 47786112 small insertion probably benign
RF042:Tfeb UTSW 17 47786097 small insertion probably benign
RF047:Tfeb UTSW 17 47786106 small insertion probably benign
RF047:Tfeb UTSW 17 47786116 small insertion probably benign
RF053:Tfeb UTSW 17 47786114 small insertion probably benign
RF054:Tfeb UTSW 17 47786098 nonsense probably null
RF060:Tfeb UTSW 17 47786106 small insertion probably benign
RF061:Tfeb UTSW 17 47786092 small insertion probably benign
RF062:Tfeb UTSW 17 47786100 small insertion probably benign
Z1177:Tfeb UTSW 17 47786524 nonsense probably null
Z1177:Tfeb UTSW 17 47791644 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AATACTTCATGGGCCTGTCTCC -3'
(R):5'- AACCTTCTGATGCTGGGAC -3'

Sequencing Primer
(F):5'- TCTCCCCTCGACTACAGGGAG -3'
(R):5'- TTCTCCAGGTAGGACTGCAC -3'
Posted On 2019-12-04