Incidental Mutation 'RF041:Gm8369'
ID 604847
Institutional Source Beutler Lab
Gene Symbol Gm8369
Ensembl Gene ENSMUSG00000058470
Gene Name predicted gene 8369
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # RF041 (G1)
Quality Score 217.468
Status Not validated
Chromosome 19
Chromosomal Location 11485938-11512577 bp(+) (GRCm38)
Type of Mutation small insertion (2 aa in frame mutation)
DNA Base Change (assembly) GTGTGT to GTGTGTATGTGT at 11511758 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079855] [ENSMUST00000163078] [ENSMUST00000186423] [ENSMUST00000188633]
AlphaFold E9PZI3
Predicted Effect probably benign
Transcript: ENSMUST00000079855
SMART Domains Protein: ENSMUSP00000132521
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 130 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163078
SMART Domains Protein: ENSMUSP00000124685
Gene: ENSMUSG00000024677

DomainStartEndE-ValueType
Pfam:CD20 47 204 4.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186423
SMART Domains Protein: ENSMUSP00000140897
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
Pfam:CD20 1 62 5.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188633
SMART Domains Protein: ENSMUSP00000141067
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
Pfam:CD20 2 48 3.7e-9 PFAM
low complexity region 130 145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik TGAGGA TGA 12: 72,881,276 probably benign Het
5430401F13Rik CCAGCAAAAACAGAAAGGAAAAGG CCAGCAAAAACAGAAAGGAAAAGGAGGCCAGCAAAAACAGAAAGGAAAAGG 6: 131,552,873 probably benign Het
5430401F13Rik AAAGGTGGC AAAGGTGGCAAGCAAAAACAGAAAGGAGAAGGTGGC 6: 131,552,892 probably benign Het
5430401F13Rik AGGTGGCCAG AGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,894 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GGCTGC GGCTGCGGCATCCTGTGCTGC 4: 155,905,100 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,229 probably benign Het
Arid1b CGG CGGTGG 17: 4,995,595 probably benign Het
AY761185 CACTGTGGG C 8: 20,943,912 probably null Het
Btnl1 C T 17: 34,381,368 T246M probably benign Het
Cdc40 C T 10: 40,843,123 D337N probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cul9 CCT CCTACT 17: 46,500,854 probably null Het
Defb22 GCTGGCCTTTGC GCTGGCCTTTGCCGCAGACCTGGCCTTTGC 2: 152,485,823 probably benign Het
Dmkn GGGGTGGAAG GGGGTGGAAGGGGTGGAAGTGGTGGAAGGGGTGGAAG 7: 30,767,173 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAATCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Flywch1 GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT 17: 23,762,177 probably null Het
Gabre CTCCGG CTCCGGATCCGG X: 72,270,049 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Il2 GG GGGCTTGAAGTGCG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTACTTTTCATTTTCCTTTT 9: 106,570,613 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
Kmt2c TG TGTTGCAG 5: 25,315,775 probably benign Het
Lce1m CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC 3: 93,018,141 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,829 probably benign Het
Med12l AGC AGCTGC 3: 59,275,985 probably benign Het
Med12l GC GCACC 3: 59,275,995 probably benign Het
Nefh CCTCACCTGGGG CCTCACCTGGGGCCTTGGGCTCACCTGGGG 11: 4,941,039 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Nusap1 GTGAGGAGCAAGCTGA GTGAGGAGCAAGCTGAAATACACGTTAGCAATGAGGAGCAAGCTGA 2: 119,627,593 probably benign Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTCGTGGTGGT 7: 127,785,332 probably benign Het
Sfr1 ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCCCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC 19: 47,732,868 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 AGC AGCCCCTGC 19: 26,631,021 probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGCGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tcof1 CCCCTTG CCCCTTGACTGCTGAGATGGGCACTTTCCCAGAGATGCCCTTG 18: 60,833,576 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Unc13b AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG AGCCAGAGCCAGAGCCAGGGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG 4: 43,177,338 probably benign Het
Usp19 GTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGT 9: 108,493,988 unknown Het
Other mutations in Gm8369
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1013:Gm8369 UTSW 19 11511783 frame shift probably null
R4192:Gm8369 UTSW 19 11502232 missense probably damaging 0.97
R5445:Gm8369 UTSW 19 11504806 missense possibly damaging 0.55
R5809:Gm8369 UTSW 19 11504884 intron probably benign
R6258:Gm8369 UTSW 19 11511609 missense possibly damaging 0.93
R6791:Gm8369 UTSW 19 11511836 unclassified probably benign
RF004:Gm8369 UTSW 19 11511754 small insertion probably benign
RF006:Gm8369 UTSW 19 11511764 small insertion probably benign
RF008:Gm8369 UTSW 19 11511754 frame shift probably null
RF016:Gm8369 UTSW 19 11511754 frame shift probably null
RF017:Gm8369 UTSW 19 11511742 frame shift probably null
RF018:Gm8369 UTSW 19 11511742 frame shift probably null
RF025:Gm8369 UTSW 19 11511773 frame shift probably null
RF028:Gm8369 UTSW 19 11511773 nonsense probably null
RF032:Gm8369 UTSW 19 11511778 small insertion probably benign
RF033:Gm8369 UTSW 19 11511778 small insertion probably benign
RF035:Gm8369 UTSW 19 11511773 small insertion probably benign
RF036:Gm8369 UTSW 19 11511778 small insertion probably benign
RF037:Gm8369 UTSW 19 11511782 small insertion probably benign
RF039:Gm8369 UTSW 19 11511758 small insertion probably benign
RF039:Gm8369 UTSW 19 11511782 small insertion probably benign
RF042:Gm8369 UTSW 19 11511773 frame shift probably null
RF042:Gm8369 UTSW 19 11511778 small insertion probably benign
RF054:Gm8369 UTSW 19 11511764 frame shift probably null
RF055:Gm8369 UTSW 19 11511748 frame shift probably null
Z1176:Gm8369 UTSW 19 11511624 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACTGACTATACTGGGTGAC -3'
(R):5'- TGCCAATTCAATGCCCTTTG -3'

Sequencing Primer
(F):5'- CTGACTATACTGGGTGACTCAATGAC -3'
(R):5'- ATTCAATGCCCTTTGTACATTAAATG -3'
Posted On 2019-12-04