Incidental Mutation 'RF041:Sfr1'
ID 604849
Institutional Source Beutler Lab
Gene Symbol Sfr1
Ensembl Gene ENSMUSG00000025066
Gene Name SWI5 dependent recombination repair 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF041 (G1)
Quality Score 183.463
Status Not validated
Chromosome 19
Chromosomal Location 47731756-47735588 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCCCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC to ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC at 47732868 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099353] [ENSMUST00000160247]
AlphaFold Q8BP27
Predicted Effect probably benign
Transcript: ENSMUST00000099353
SMART Domains Protein: ENSMUSP00000096954
Gene: ENSMUSG00000025066

DomainStartEndE-ValueType
low complexity region 16 61 N/A INTRINSIC
Pfam:Mei5 104 310 4.8e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160247
SMART Domains Protein: ENSMUSP00000125007
Gene: ENSMUSG00000044948

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
Blast:WD40 70 111 6e-7 BLAST
Blast:WD40 115 156 1e-5 BLAST
Blast:WD40 162 197 8e-10 BLAST
WD40 349 388 1.07e0 SMART
Blast:WD40 392 432 3e-13 BLAST
WD40 435 473 3.96e1 SMART
WD40 479 518 3.82e1 SMART
Blast:WD40 638 683 8e-17 BLAST
Blast:WD40 689 728 1e-17 BLAST
low complexity region 766 781 N/A INTRINSIC
coiled coil region 855 886 N/A INTRINSIC
coiled coil region 925 961 N/A INTRINSIC
low complexity region 971 981 N/A INTRINSIC
coiled coil region 1170 1224 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
low complexity region 1268 1279 N/A INTRINSIC
low complexity region 1524 1529 N/A INTRINSIC
coiled coil region 1652 1671 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik TGAGGA TGA 12: 72,881,276 probably benign Het
5430401F13Rik CCAGCAAAAACAGAAAGGAAAAGG CCAGCAAAAACAGAAAGGAAAAGGAGGCCAGCAAAAACAGAAAGGAAAAGG 6: 131,552,873 probably benign Het
5430401F13Rik AAAGGTGGC AAAGGTGGCAAGCAAAAACAGAAAGGAGAAGGTGGC 6: 131,552,892 probably benign Het
5430401F13Rik AGGTGGCCAG AGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,894 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GGCTGC GGCTGCGGCATCCTGTGCTGC 4: 155,905,100 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,229 probably benign Het
Arid1b CGG CGGTGG 17: 4,995,595 probably benign Het
AY761185 CACTGTGGG C 8: 20,943,912 probably null Het
Btnl1 C T 17: 34,381,368 T246M probably benign Het
Cdc40 C T 10: 40,843,123 D337N probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cul9 CCT CCTACT 17: 46,500,854 probably null Het
Defb22 GCTGGCCTTTGC GCTGGCCTTTGCCGCAGACCTGGCCTTTGC 2: 152,485,823 probably benign Het
Dmkn GGGGTGGAAG GGGGTGGAAGGGGTGGAAGTGGTGGAAGGGGTGGAAG 7: 30,767,173 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAATCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Flywch1 GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT 17: 23,762,177 probably null Het
Gabre CTCCGG CTCCGGATCCGG X: 72,270,049 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,758 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Il2 GG GGGCTTGAAGTGCG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTACTTTTCATTTTCCTTTT 9: 106,570,613 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
Kmt2c TG TGTTGCAG 5: 25,315,775 probably benign Het
Lce1m CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC 3: 93,018,141 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,829 probably benign Het
Med12l AGC AGCTGC 3: 59,275,985 probably benign Het
Med12l GC GCACC 3: 59,275,995 probably benign Het
Nefh CCTCACCTGGGG CCTCACCTGGGGCCTTGGGCTCACCTGGGG 11: 4,941,039 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Nusap1 GTGAGGAGCAAGCTGA GTGAGGAGCAAGCTGAAATACACGTTAGCAATGAGGAGCAAGCTGA 2: 119,627,593 probably benign Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTCGTGGTGGT 7: 127,785,332 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 AGC AGCCCCTGC 19: 26,631,021 probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGCGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tcof1 CCCCTTG CCCCTTGACTGCTGAGATGGGCACTTTCCCAGAGATGCCCTTG 18: 60,833,576 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Unc13b AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG AGCCAGAGCCAGAGCCAGGGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG 4: 43,177,338 probably benign Het
Usp19 GTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGT 9: 108,493,988 unknown Het
Other mutations in Sfr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02483:Sfr1 APN 19 47732788 unclassified probably benign
IGL02516:Sfr1 APN 19 47732990 critical splice donor site probably null
R0128:Sfr1 UTSW 19 47735018 makesense probably null
R1282:Sfr1 UTSW 19 47732968 missense probably damaging 1.00
R1373:Sfr1 UTSW 19 47734916 missense possibly damaging 0.84
R1396:Sfr1 UTSW 19 47733690 missense probably benign 0.37
R1709:Sfr1 UTSW 19 47735003 missense possibly damaging 0.76
R2306:Sfr1 UTSW 19 47734852 missense probably damaging 1.00
R5634:Sfr1 UTSW 19 47733871 missense probably damaging 1.00
R6714:Sfr1 UTSW 19 47734966 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCAGCATCGACTTCACCTG -3'
(R):5'- TCACACTCCAGTAGCCTTAAAACTG -3'

Sequencing Primer
(F):5'- TGATGCTCCTCAGCCCAGTG -3'
(R):5'- CCTTAAAACTGGCACTATCAGAATAC -3'
Posted On 2019-12-04