Incidental Mutation 'RF041:Mamld1'
ID 604850
Institutional Source Beutler Lab
Gene Symbol Mamld1
Ensembl Gene ENSMUSG00000059401
Gene Name mastermind-like domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock # RF041 (G1)
Quality Score 142.467
Status Not validated
Chromosome X
Chromosomal Location 71050256-71156056 bp(+) (GRCm38)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) AGC to AGCCGC at 71118826 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082088] [ENSMUST00000114629]
AlphaFold P0C6A2
Predicted Effect probably benign
Transcript: ENSMUST00000082088
SMART Domains Protein: ENSMUSP00000080737
Gene: ENSMUSG00000059401

DomainStartEndE-ValueType
low complexity region 153 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
internal_repeat_1 363 414 3.74e-7 PROSPERO
internal_repeat_1 418 466 3.74e-7 PROSPERO
low complexity region 571 588 N/A INTRINSIC
low complexity region 592 637 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114629
SMART Domains Protein: ENSMUSP00000110276
Gene: ENSMUSG00000059401

DomainStartEndE-ValueType
low complexity region 153 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
internal_repeat_1 363 414 2.31e-7 PROSPERO
internal_repeat_1 418 466 2.31e-7 PROSPERO
low complexity region 571 588 N/A INTRINSIC
low complexity region 592 637 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice exhibit normal male genitalia and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik TGAGGA TGA 12: 72,881,276 probably benign Het
5430401F13Rik CCAGCAAAAACAGAAAGGAAAAGG CCAGCAAAAACAGAAAGGAAAAGGAGGCCAGCAAAAACAGAAAGGAAAAGG 6: 131,552,873 probably benign Het
5430401F13Rik AAAGGTGGC AAAGGTGGCAAGCAAAAACAGAAAGGAGAAGGTGGC 6: 131,552,892 probably benign Het
5430401F13Rik AGGTGGCCAG AGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,894 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GGCTGC GGCTGCGGCATCCTGTGCTGC 4: 155,905,100 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,229 probably benign Het
Arid1b CGG CGGTGG 17: 4,995,595 probably benign Het
AY761185 CACTGTGGG C 8: 20,943,912 probably null Het
Btnl1 C T 17: 34,381,368 T246M probably benign Het
Cdc40 C T 10: 40,843,123 D337N probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cul9 CCT CCTACT 17: 46,500,854 probably null Het
Defb22 GCTGGCCTTTGC GCTGGCCTTTGCCGCAGACCTGGCCTTTGC 2: 152,485,823 probably benign Het
Dmkn GGGGTGGAAG GGGGTGGAAGGGGTGGAAGTGGTGGAAGGGGTGGAAG 7: 30,767,173 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAATCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Flywch1 GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT 17: 23,762,177 probably null Het
Gabre CTCCGG CTCCGGATCCGG X: 72,270,049 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,758 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Il2 GG GGGCTTGAAGTGCG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTACTTTTCATTTTCCTTTT 9: 106,570,613 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
Kmt2c TG TGTTGCAG 5: 25,315,775 probably benign Het
Lce1m CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC 3: 93,018,141 probably benign Het
Med12l AGC AGCTGC 3: 59,275,985 probably benign Het
Med12l GC GCACC 3: 59,275,995 probably benign Het
Nefh CCTCACCTGGGG CCTCACCTGGGGCCTTGGGCTCACCTGGGG 11: 4,941,039 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Nusap1 GTGAGGAGCAAGCTGA GTGAGGAGCAAGCTGAAATACACGTTAGCAATGAGGAGCAAGCTGA 2: 119,627,593 probably benign Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTCGTGGTGGT 7: 127,785,332 probably benign Het
Sfr1 ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCCCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC 19: 47,732,868 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 AGC AGCCCCTGC 19: 26,631,021 probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGCGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tcof1 CCCCTTG CCCCTTGACTGCTGAGATGGGCACTTTCCCAGAGATGCCCTTG 18: 60,833,576 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Unc13b AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG AGCCAGAGCCAGAGCCAGGGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG 4: 43,177,338 probably benign Het
Usp19 GTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGT 9: 108,493,988 unknown Het
Other mutations in Mamld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02484:Mamld1 APN X 71118652 missense possibly damaging 0.93
FR4340:Mamld1 UTSW X 71118846 small insertion probably benign
FR4737:Mamld1 UTSW X 71118835 small insertion probably benign
FR4737:Mamld1 UTSW X 71118839 small insertion probably benign
FR4976:Mamld1 UTSW X 71118812 small insertion probably benign
FR4976:Mamld1 UTSW X 71118818 small insertion probably benign
R2133:Mamld1 UTSW X 71119392 missense probably benign 0.00
R2277:Mamld1 UTSW X 71118815 small deletion probably benign
RF003:Mamld1 UTSW X 71118820 small insertion probably benign
RF004:Mamld1 UTSW X 71118831 nonsense probably null
RF014:Mamld1 UTSW X 71118845 small insertion probably benign
RF015:Mamld1 UTSW X 71118820 small insertion probably benign
RF015:Mamld1 UTSW X 71118841 small insertion probably benign
RF018:Mamld1 UTSW X 71118849 small insertion probably benign
RF022:Mamld1 UTSW X 71118820 small insertion probably benign
RF025:Mamld1 UTSW X 71118826 small insertion probably benign
RF030:Mamld1 UTSW X 71118828 nonsense probably null
RF033:Mamld1 UTSW X 71118833 small insertion probably benign
RF034:Mamld1 UTSW X 71118835 small insertion probably benign
RF035:Mamld1 UTSW X 71118812 small insertion probably benign
RF035:Mamld1 UTSW X 71118838 small insertion probably benign
RF035:Mamld1 UTSW X 71118850 small insertion probably benign
RF036:Mamld1 UTSW X 71118828 small insertion probably benign
RF036:Mamld1 UTSW X 71118835 small insertion probably benign
RF036:Mamld1 UTSW X 71118840 small insertion probably benign
RF038:Mamld1 UTSW X 71118846 small insertion probably benign
RF039:Mamld1 UTSW X 71118826 small insertion probably benign
RF039:Mamld1 UTSW X 71118840 small insertion probably benign
RF040:Mamld1 UTSW X 71118814 small insertion probably benign
RF041:Mamld1 UTSW X 71118829 small insertion probably benign
RF042:Mamld1 UTSW X 71118812 small insertion probably benign
RF042:Mamld1 UTSW X 71118853 small insertion probably benign
RF043:Mamld1 UTSW X 71118835 small insertion probably benign
RF047:Mamld1 UTSW X 71118839 small insertion probably benign
RF048:Mamld1 UTSW X 71118852 nonsense probably null
RF049:Mamld1 UTSW X 71118833 small insertion probably benign
RF049:Mamld1 UTSW X 71118845 small insertion probably benign
RF053:Mamld1 UTSW X 71118852 small insertion probably benign
RF055:Mamld1 UTSW X 71118837 small insertion probably benign
RF059:Mamld1 UTSW X 71118832 small insertion probably benign
RF060:Mamld1 UTSW X 71118831 nonsense probably null
RF060:Mamld1 UTSW X 71118832 small insertion probably benign
RF061:Mamld1 UTSW X 71118850 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GATATCTGCTCTGCCTACCAGC -3'
(R):5'- ACATGGAGGCCATCTTCTGG -3'

Sequencing Primer
(F):5'- TACCAGCACCCCAGGGC -3'
(R):5'- CTTGGCTCAGAAACAAAATGTGAC -3'
Posted On 2019-12-04