Incidental Mutation 'RF041:Gabre'
ID 604852
Institutional Source Beutler Lab
Gene Symbol Gabre
Ensembl Gene ENSMUSG00000031340
Gene Name gamma-aminobutyric acid (GABA) A receptor, subunit epsilon
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock # RF041 (G1)
Quality Score 137.525
Status Not validated
Chromosome X
Chromosomal Location 72255999-72274803 bp(-) (GRCm38)
Type of Mutation small insertion (2 aa in frame mutation)
DNA Base Change (assembly) CTCCGG to CTCCGGATCCGG at 72270049 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064780]
AlphaFold A2AMW3
Predicted Effect probably benign
Transcript: ENSMUST00000064780
SMART Domains Protein: ENSMUSP00000066543
Gene: ENSMUSG00000031340

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 40 55 N/A INTRINSIC
low complexity region 83 169 N/A INTRINSIC
low complexity region 173 219 N/A INTRINSIC
low complexity region 234 441 N/A INTRINSIC
Pfam:Neur_chan_LBD 482 688 1.4e-47 PFAM
Pfam:Neur_chan_memb 695 856 2.1e-23 PFAM
transmembrane domain 892 914 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik TGAGGA TGA 12: 72,881,276 probably benign Het
5430401F13Rik CCAGCAAAAACAGAAAGGAAAAGG CCAGCAAAAACAGAAAGGAAAAGGAGGCCAGCAAAAACAGAAAGGAAAAGG 6: 131,552,873 probably benign Het
5430401F13Rik AAAGGTGGC AAAGGTGGCAAGCAAAAACAGAAAGGAGAAGGTGGC 6: 131,552,892 probably benign Het
5430401F13Rik AGGTGGCCAG AGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,894 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GGCTGC GGCTGCGGCATCCTGTGCTGC 4: 155,905,100 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,229 probably benign Het
Arid1b CGG CGGTGG 17: 4,995,595 probably benign Het
AY761185 CACTGTGGG C 8: 20,943,912 probably null Het
Btnl1 C T 17: 34,381,368 T246M probably benign Het
Cdc40 C T 10: 40,843,123 D337N probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cul9 CCT CCTACT 17: 46,500,854 probably null Het
Defb22 GCTGGCCTTTGC GCTGGCCTTTGCCGCAGACCTGGCCTTTGC 2: 152,485,823 probably benign Het
Dmkn GGGGTGGAAG GGGGTGGAAGGGGTGGAAGTGGTGGAAGGGGTGGAAG 7: 30,767,173 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAATCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Flywch1 GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT 17: 23,762,177 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,758 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Il2 GG GGGCTTGAAGTGCG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTACTTTTCATTTTCCTTTT 9: 106,570,613 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
Kmt2c TG TGTTGCAG 5: 25,315,775 probably benign Het
Lce1m CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC 3: 93,018,141 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,829 probably benign Het
Med12l AGC AGCTGC 3: 59,275,985 probably benign Het
Med12l GC GCACC 3: 59,275,995 probably benign Het
Nefh CCTCACCTGGGG CCTCACCTGGGGCCTTGGGCTCACCTGGGG 11: 4,941,039 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Nusap1 GTGAGGAGCAAGCTGA GTGAGGAGCAAGCTGAAATACACGTTAGCAATGAGGAGCAAGCTGA 2: 119,627,593 probably benign Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTCGTGGTGGT 7: 127,785,332 probably benign Het
Sfr1 ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCCCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC 19: 47,732,868 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 AGC AGCCCCTGC 19: 26,631,021 probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGCGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tcof1 CCCCTTG CCCCTTGACTGCTGAGATGGGCACTTTCCCAGAGATGCCCTTG 18: 60,833,576 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Unc13b AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG AGCCAGAGCCAGAGCCAGGGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG 4: 43,177,338 probably benign Het
Usp19 GTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGT 9: 108,493,988 unknown Het
Other mutations in Gabre
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Gabre APN X 72274653 nonsense probably null
FR4304:Gabre UTSW X 72270042 small insertion probably benign
FR4589:Gabre UTSW X 72270030 small insertion probably benign
FR4589:Gabre UTSW X 72270042 small insertion probably benign
FR4976:Gabre UTSW X 72270418 small insertion probably benign
FR4976:Gabre UTSW X 72270422 small insertion probably benign
R7620:Gabre UTSW X 72270259 missense unknown
RF002:Gabre UTSW X 72270057 nonsense probably null
RF005:Gabre UTSW X 72270045 nonsense probably null
RF009:Gabre UTSW X 72270712 small deletion probably benign
RF009:Gabre UTSW X 72270713 small insertion probably benign
RF010:Gabre UTSW X 72270060 small insertion probably benign
RF013:Gabre UTSW X 72270416 small insertion probably benign
RF023:Gabre UTSW X 72270054 small insertion probably benign
RF024:Gabre UTSW X 72270177 frame shift probably null
RF028:Gabre UTSW X 72270763 small insertion probably benign
RF029:Gabre UTSW X 72270059 small insertion probably benign
RF034:Gabre UTSW X 72270762 small insertion probably benign
RF037:Gabre UTSW X 72270061 small insertion probably benign
RF042:Gabre UTSW X 72270047 small insertion probably benign
RF043:Gabre UTSW X 72270048 small insertion probably benign
RF044:Gabre UTSW X 72270061 small insertion probably benign
RF045:Gabre UTSW X 72270045 small insertion probably benign
RF045:Gabre UTSW X 72270181 frame shift probably null
RF047:Gabre UTSW X 72270053 small insertion probably benign
RF047:Gabre UTSW X 72270765 nonsense probably null
RF049:Gabre UTSW X 72270277 frame shift probably null
RF050:Gabre UTSW X 72270741 nonsense probably null
RF051:Gabre UTSW X 72270049 small insertion probably benign
RF052:Gabre UTSW X 72270047 small insertion probably benign
RF054:Gabre UTSW X 72270416 small insertion probably benign
RF055:Gabre UTSW X 72270177 frame shift probably null
RF058:Gabre UTSW X 72270063 small insertion probably benign
RF059:Gabre UTSW X 72270764 small insertion probably benign
RF061:Gabre UTSW X 72270048 small insertion probably benign
RF064:Gabre UTSW X 72270063 nonsense probably null
RF064:Gabre UTSW X 72270171 frame shift probably null
X0018:Gabre UTSW X 72270338 missense unknown
Predicted Primers PCR Primer
(F):5'- GGACTGGGGCTCTGATTTCAT -3'
(R):5'- CCTCAGCCTCAGCCTCTGG -3'

Sequencing Primer
(F):5'- ACTGGGGCTCTGATTTCATCTCTG -3'
(R):5'- TCAGCCTGAGCCACAGC -3'
Posted On 2019-12-04