Incidental Mutation 'RF042:Krtap28-10'
ID604854
Institutional Source Beutler Lab
Gene Symbol Krtap28-10
Ensembl Gene ENSMUSG00000100190
Gene Namekeratin associated protein 28-10
Synonyms4733401N17Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF042 (G1)
Quality Score216.586
Status Not validated
Chromosome1
Chromosomal Location83041524-83042480 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CCACAG to CCACAGACACAG at 83042125 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473] [ENSMUST00000188323] [ENSMUST00000222567]
Predicted Effect probably benign
Transcript: ENSMUST00000045560
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164473
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188323
Predicted Effect probably benign
Transcript: ENSMUST00000222567
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,217 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 TCT TCTACT X: 75,000,005 probably benign Het
Gab3 TTC TTCGTC X: 75,000,022 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Iqcf4 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT 9: 106,570,605 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lca5l GCCCTGGCCCTGGCCCC GCCC 16: 96,159,297 probably null Het
Lce1m CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC 3: 93,018,139 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 A AGCC X: 71,118,853 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Pdia4 CTCTTCCTCCT C 6: 47,808,306 probably null Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sbp AAGA AAGACGCTGACAACAGAGA 17: 23,945,384 probably benign Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Slc39a4 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC 15: 76,614,871 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Krtap28-10
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Krtap28-10 UTSW 1 83042123 unclassified probably benign
RF001:Krtap28-10 UTSW 1 83042255 unclassified probably benign
RF001:Krtap28-10 UTSW 1 83042280 unclassified probably benign
RF001:Krtap28-10 UTSW 1 83042282 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042128 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042135 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042253 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042279 unclassified probably benign
RF012:Krtap28-10 UTSW 1 83042136 unclassified probably benign
RF013:Krtap28-10 UTSW 1 83042135 unclassified probably benign
RF013:Krtap28-10 UTSW 1 83042274 unclassified probably benign
RF014:Krtap28-10 UTSW 1 83042251 unclassified probably benign
RF016:Krtap28-10 UTSW 1 83042123 unclassified probably benign
RF017:Krtap28-10 UTSW 1 83042138 unclassified probably benign
RF017:Krtap28-10 UTSW 1 83042266 unclassified probably benign
RF018:Krtap28-10 UTSW 1 83042253 unclassified probably benign
RF019:Krtap28-10 UTSW 1 83042269 unclassified probably benign
RF023:Krtap28-10 UTSW 1 83042146 nonsense probably null
RF023:Krtap28-10 UTSW 1 83042286 unclassified probably benign
RF024:Krtap28-10 UTSW 1 83042123 unclassified probably benign
RF024:Krtap28-10 UTSW 1 83042252 unclassified probably benign
RF025:Krtap28-10 UTSW 1 83042258 unclassified probably benign
RF026:Krtap28-10 UTSW 1 83042126 unclassified probably benign
RF027:Krtap28-10 UTSW 1 83042285 unclassified probably benign
RF028:Krtap28-10 UTSW 1 83042258 unclassified probably benign
RF029:Krtap28-10 UTSW 1 83042270 unclassified probably benign
RF032:Krtap28-10 UTSW 1 83042258 unclassified probably benign
RF034:Krtap28-10 UTSW 1 83042282 unclassified probably benign
RF035:Krtap28-10 UTSW 1 83042146 unclassified probably benign
RF035:Krtap28-10 UTSW 1 83042281 unclassified probably benign
RF037:Krtap28-10 UTSW 1 83042145 unclassified probably benign
RF037:Krtap28-10 UTSW 1 83042286 unclassified probably benign
RF038:Krtap28-10 UTSW 1 83042128 unclassified probably benign
RF038:Krtap28-10 UTSW 1 83042257 unclassified probably benign
RF044:Krtap28-10 UTSW 1 83042131 unclassified probably benign
RF045:Krtap28-10 UTSW 1 83042143 unclassified probably benign
RF045:Krtap28-10 UTSW 1 83042261 unclassified probably benign
RF049:Krtap28-10 UTSW 1 83042138 unclassified probably benign
RF049:Krtap28-10 UTSW 1 83042285 unclassified probably benign
RF053:Krtap28-10 UTSW 1 83042278 unclassified probably benign
RF055:Krtap28-10 UTSW 1 83042130 unclassified probably benign
RF055:Krtap28-10 UTSW 1 83042262 unclassified probably benign
RF055:Krtap28-10 UTSW 1 83042270 unclassified probably benign
RF058:Krtap28-10 UTSW 1 83042262 unclassified probably benign
RF059:Krtap28-10 UTSW 1 83042275 unclassified probably benign
RF059:Krtap28-10 UTSW 1 83042290 unclassified probably benign
RF061:Krtap28-10 UTSW 1 83042281 unclassified probably benign
RF064:Krtap28-10 UTSW 1 83042131 unclassified probably benign
Z1177:Krtap28-10 UTSW 1 83042159 missense unknown
Predicted Primers PCR Primer
(F):5'- GAGCATTTCCAGTGGGTAGATG -3'
(R):5'- TCCTCTCTACTGACAACATGGG -3'

Sequencing Primer
(F):5'- CATTTCCAGTGGGTAGATGAAAAG -3'
(R):5'- CTGTGGAGGCTGCGGAG -3'
Posted On2019-12-04