Incidental Mutation 'RF042:Anapc2'
ID604855
Institutional Source Beutler Lab
Gene Symbol Anapc2
Ensembl Gene ENSMUSG00000026965
Gene Nameanaphase promoting complex subunit 2
SynonymsEmi4, 9230107K09Rik, Imi4, expressed during mesenchymal induction 4, APC2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF042 (G1)
Quality Score214.458
Status Not validated
Chromosome2
Chromosomal Location25272478-25285915 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GCGGCGGCGGCGAC to GC at 25272561 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028341] [ENSMUST00000028342] [ENSMUST00000114336] [ENSMUST00000129300]
Predicted Effect probably benign
Transcript: ENSMUST00000028341
SMART Domains Protein: ENSMUSP00000028341
Gene: ENSMUSG00000026965

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 123 133 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 221 229 N/A INTRINSIC
low complexity region 456 467 N/A INTRINSIC
CULLIN 515 663 6.72e-9 SMART
APC2 772 832 3.67e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028342
SMART Domains Protein: ENSMUSP00000028342
Gene: ENSMUSG00000026966

DomainStartEndE-ValueType
coiled coil region 13 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114336
SMART Domains Protein: ENSMUSP00000109975
Gene: ENSMUSG00000048707

DomainStartEndE-ValueType
Pfam:Phostensin_N 8 89 8.3e-38 PFAM
low complexity region 105 117 N/A INTRINSIC
internal_repeat_1 149 273 1.71e-5 PROSPERO
low complexity region 290 322 N/A INTRINSIC
low complexity region 401 410 N/A INTRINSIC
Pfam:Phostensin 506 645 1.8e-65 PFAM
low complexity region 647 665 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129300
SMART Domains Protein: ENSMUSP00000115177
Gene: ENSMUSG00000026965

DomainStartEndE-ValueType
low complexity region 170 181 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle by ubiquitinating its specific substrates, such as mitotic cyclins and anaphase inhibitor, for subsequent degradation by the proteasome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before E6.5. Conditional ablation in the liver results in liver failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,217 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 TCT TCTACT X: 75,000,005 probably benign Het
Gab3 TTC TTCGTC X: 75,000,022 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Iqcf4 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT 9: 106,570,605 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,125 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lca5l GCCCTGGCCCTGGCCCC GCCC 16: 96,159,297 probably null Het
Lce1m CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC 3: 93,018,139 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 A AGCC X: 71,118,853 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Pdia4 CTCTTCCTCCT C 6: 47,808,306 probably null Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sbp AAGA AAGACGCTGACAACAGAGA 17: 23,945,384 probably benign Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Slc39a4 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC 15: 76,614,871 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Anapc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Anapc2 APN 2 25274782 missense possibly damaging 0.65
IGL01575:Anapc2 APN 2 25285176 splice site probably benign
IGL01993:Anapc2 APN 2 25274713 missense probably benign 0.00
IGL02586:Anapc2 APN 2 25285096 missense probably benign 0.08
IGL02721:Anapc2 APN 2 25274668 nonsense probably null
FR4976:Anapc2 UTSW 2 25272532 unclassified probably benign
R0415:Anapc2 UTSW 2 25278325 missense probably damaging 1.00
R1539:Anapc2 UTSW 2 25273063 missense probably benign
R1675:Anapc2 UTSW 2 25272639 missense possibly damaging 0.88
R1720:Anapc2 UTSW 2 25274712 missense probably benign 0.13
R2150:Anapc2 UTSW 2 25272670 missense probably benign 0.27
R2173:Anapc2 UTSW 2 25273276 missense probably benign 0.01
R4028:Anapc2 UTSW 2 25277738 missense probably damaging 1.00
R4254:Anapc2 UTSW 2 25273345 missense probably benign 0.08
R4643:Anapc2 UTSW 2 25276394 missense probably benign
R4742:Anapc2 UTSW 2 25273543 splice site probably null
R4824:Anapc2 UTSW 2 25277752 missense probably damaging 1.00
R5039:Anapc2 UTSW 2 25274796 missense possibly damaging 0.70
R5530:Anapc2 UTSW 2 25284583 missense possibly damaging 0.81
R6456:Anapc2 UTSW 2 25280195 missense probably damaging 1.00
R6479:Anapc2 UTSW 2 25285395 missense probably benign 0.04
R6587:Anapc2 UTSW 2 25272538 unclassified probably benign
R7164:Anapc2 UTSW 2 25284999 missense probably damaging 1.00
R7494:Anapc2 UTSW 2 25276364 missense possibly damaging 0.95
R7829:Anapc2 UTSW 2 25277741 missense probably damaging 1.00
R7954:Anapc2 UTSW 2 25274700 missense probably damaging 1.00
R7970:Anapc2 UTSW 2 25273287 missense possibly damaging 0.85
R8015:Anapc2 UTSW 2 25284676 missense probably benign 0.08
R8064:Anapc2 UTSW 2 25276406 missense probably benign
RF043:Anapc2 UTSW 2 25272561 unclassified probably benign
RF062:Anapc2 UTSW 2 25272537 frame shift probably null
X0025:Anapc2 UTSW 2 25279278 missense probably benign 0.01
Z1088:Anapc2 UTSW 2 25273368 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTGTAGTTCTGCAGCGCC -3'
(R):5'- CAAAGTCGCGGGAAATCTGC -3'

Sequencing Primer
(F):5'- TGGGTCATGGTCTGCACC -3'
(R):5'- CGGGAAATCTGCACAGGC -3'
Posted On2019-12-04