Incidental Mutation 'RF042:Lce1m'
ID604862
Institutional Source Beutler Lab
Gene Symbol Lce1m
Ensembl Gene ENSMUSG00000027912
Gene Namelate cornified envelope 1M
SynonymsSprrl10, Lce5a, 1110059L13Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF042 (G1)
Quality Score217.468
Status Not validated
Chromosome3
Chromosomal Location93017810-93019060 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CACTGCTGCTGC to CACTGCTGCTGCAACTGCTGCTGC at 93018139 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029520] [ENSMUST00000029521] [ENSMUST00000107301] [ENSMUST00000193944]
Predicted Effect probably benign
Transcript: ENSMUST00000029520
SMART Domains Protein: ENSMUSP00000029520
Gene: ENSMUSG00000027912

DomainStartEndE-ValueType
Pfam:LCE 9 96 5.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029521
SMART Domains Protein: ENSMUSP00000029521
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
low complexity region 12 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107301
SMART Domains Protein: ENSMUSP00000102922
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
Pfam:NICE-1 5 100 5.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193944
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,217 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 TCT TCTACT X: 75,000,005 probably benign Het
Gab3 TTC TTCGTC X: 75,000,022 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Iqcf4 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT 9: 106,570,605 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,125 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lca5l GCCCTGGCCCTGGCCCC GCCC 16: 96,159,297 probably null Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 A AGCC X: 71,118,853 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Pdia4 CTCTTCCTCCT C 6: 47,808,306 probably null Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sbp AAGA AAGACGCTGACAACAGAGA 17: 23,945,384 probably benign Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Slc39a4 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC 15: 76,614,871 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Lce1m
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4342:Lce1m UTSW 3 93018247 unclassified probably benign
FR4449:Lce1m UTSW 3 93018152 unclassified probably benign
FR4589:Lce1m UTSW 3 93018268 unclassified probably benign
FR4976:Lce1m UTSW 3 93018148 unclassified probably benign
R1513:Lce1m UTSW 3 93018625 unclassified probably benign
R7621:Lce1m UTSW 3 93017870 splice site probably null
R7753:Lce1m UTSW 3 93018508 missense unknown
RF001:Lce1m UTSW 3 93018152 unclassified probably benign
RF001:Lce1m UTSW 3 93018269 unclassified probably benign
RF002:Lce1m UTSW 3 93018283 unclassified probably benign
RF002:Lce1m UTSW 3 93018299 unclassified probably benign
RF007:Lce1m UTSW 3 93018144 unclassified probably benign
RF009:Lce1m UTSW 3 93018131 unclassified probably benign
RF010:Lce1m UTSW 3 93018290 unclassified probably benign
RF015:Lce1m UTSW 3 93018148 unclassified probably benign
RF021:Lce1m UTSW 3 93018269 unclassified probably benign
RF021:Lce1m UTSW 3 93018295 unclassified probably benign
RF023:Lce1m UTSW 3 93018280 unclassified probably benign
RF026:Lce1m UTSW 3 93018138 unclassified probably benign
RF026:Lce1m UTSW 3 93018143 unclassified probably benign
RF028:Lce1m UTSW 3 93018131 unclassified probably benign
RF030:Lce1m UTSW 3 93018141 unclassified probably benign
RF030:Lce1m UTSW 3 93018344 unclassified probably benign
RF037:Lce1m UTSW 3 93018300 unclassified probably benign
RF041:Lce1m UTSW 3 93018141 unclassified probably benign
RF045:Lce1m UTSW 3 93018292 unclassified probably benign
RF046:Lce1m UTSW 3 93018293 unclassified probably benign
RF054:Lce1m UTSW 3 93018298 unclassified probably benign
RF059:Lce1m UTSW 3 93018329 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCTCGTGGTAGATGAGCTTTAG -3'
(R):5'- CACAGCTCTGGATGCTGTAG -3'

Sequencing Primer
(F):5'- CTTTAGGGAGATGAAGAGGACGTAC -3'
(R):5'- TGTAGCAGCGGTGGCAG -3'
Posted On2019-12-04