Incidental Mutation 'RF042:Srpk2'
ID604864
Institutional Source Beutler Lab
Gene Symbol Srpk2
Ensembl Gene ENSMUSG00000062604
Gene Nameserine/arginine-rich protein specific kinase 2
SynonymsWBP6, mSRPK2
Accession Numbers

NCBI RefSeq: NM_009274.2; MGI:1201408

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF042 (G1)
Quality Score149.457
Status Not validated
Chromosome5
Chromosomal Location23503264-23684617 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) ATCCT to AT at 23525575 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088392] [ENSMUST00000196388] [ENSMUST00000196929]
Predicted Effect probably benign
Transcript: ENSMUST00000088392
SMART Domains Protein: ENSMUSP00000085734
Gene: ENSMUSG00000062604

DomainStartEndE-ValueType
low complexity region 5 46 N/A INTRINSIC
Pfam:Pkinase 79 228 1.3e-22 PFAM
Pfam:Pkinase_Tyr 79 228 1e-9 PFAM
coiled coil region 263 314 N/A INTRINSIC
coiled coil region 339 373 N/A INTRINSIC
low complexity region 393 406 N/A INTRINSIC
Pfam:Pkinase 506 680 1.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196388
SMART Domains Protein: ENSMUSP00000143453
Gene: ENSMUSG00000062604

DomainStartEndE-ValueType
S_TKc 3 129 7.2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196929
SMART Domains Protein: ENSMUSP00000143216
Gene: ENSMUSG00000062604

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 131 2.6e-8 PFAM
Pfam:Pkinase 2 130 2.3e-18 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(3) Gene trapped(36)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,217 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 TCT TCTACT X: 75,000,005 probably benign Het
Gab3 TTC TTCGTC X: 75,000,022 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Iqcf4 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT 9: 106,570,605 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,125 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lca5l GCCCTGGCCCTGGCCCC GCCC 16: 96,159,297 probably null Het
Lce1m CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC 3: 93,018,139 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 A AGCC X: 71,118,853 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Pdia4 CTCTTCCTCCT C 6: 47,808,306 probably null Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sbp AAGA AAGACGCTGACAACAGAGA 17: 23,945,384 probably benign Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Slc39a4 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC 15: 76,614,871 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Srpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Srpk2 APN 5 23540379 missense probably benign 0.10
IGL02057:Srpk2 APN 5 23518707 missense probably damaging 0.99
IGL02217:Srpk2 APN 5 23545570 missense probably damaging 1.00
IGL03115:Srpk2 APN 5 23524618 splice site probably null
FR4737:Srpk2 UTSW 5 23545196 unclassified probably null
P0008:Srpk2 UTSW 5 23513978 missense probably damaging 1.00
R0142:Srpk2 UTSW 5 23527930 missense probably damaging 0.97
R0462:Srpk2 UTSW 5 23518426 missense probably damaging 1.00
R0992:Srpk2 UTSW 5 23545543 missense probably damaging 0.99
R1569:Srpk2 UTSW 5 23514026 missense probably damaging 1.00
R1677:Srpk2 UTSW 5 23525750 splice site probably null
R1696:Srpk2 UTSW 5 23548494 nonsense probably null
R1752:Srpk2 UTSW 5 23528019 missense probably damaging 1.00
R1862:Srpk2 UTSW 5 23524150 missense probably benign 0.32
R1989:Srpk2 UTSW 5 23518423 missense probably damaging 1.00
R2173:Srpk2 UTSW 5 23518615 splice site probably null
R4096:Srpk2 UTSW 5 23540502 intron probably benign
R4271:Srpk2 UTSW 5 23548515 missense possibly damaging 0.95
R4894:Srpk2 UTSW 5 23545529 missense probably damaging 1.00
R5043:Srpk2 UTSW 5 23524517 missense probably benign
R5044:Srpk2 UTSW 5 23524392 missense possibly damaging 0.91
R5309:Srpk2 UTSW 5 23525718 missense probably damaging 0.97
R5478:Srpk2 UTSW 5 23524183 missense possibly damaging 0.71
R5568:Srpk2 UTSW 5 23525699 missense possibly damaging 0.73
R5665:Srpk2 UTSW 5 23518477 missense probably damaging 0.99
R5678:Srpk2 UTSW 5 23524606 frame shift probably null
R6364:Srpk2 UTSW 5 23540467 missense probably damaging 1.00
R7201:Srpk2 UTSW 5 23507628 missense possibly damaging 0.64
R7597:Srpk2 UTSW 5 23548519 missense possibly damaging 0.96
R8251:Srpk2 UTSW 5 23524268 missense probably benign
RF035:Srpk2 UTSW 5 23525575 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- CTCAGATGCTCTAAGGCACTC -3'
(R):5'- TGACCCATGGCATCACACTTC -3'

Sequencing Primer
(F):5'- CAGATGCTCTAAGGCACTCTGTGG -3'
(R):5'- CACTTTCTTACCATGTTGTAGATAGG -3'
Posted On2019-12-04