Incidental Mutation 'RF042:Tgoln1'
ID604869
Institutional Source Beutler Lab
Gene Symbol Tgoln1
Ensembl Gene ENSMUSG00000056429
Gene Nametrans-golgi network protein
SynonymsTtgn1, D6Ertd384e, TGN38, TGN38A
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #RF042 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location72608432-72617000 bp(-) (GRCm38)
Type of Mutationsmall insertion (8 aa in frame mutation)
DNA Base Change (assembly) T to TCACCTCCCGTGGGCTTGCCAGAAG at 72616074 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070524]
Predicted Effect probably benign
Transcript: ENSMUST00000070524
SMART Domains Protein: ENSMUSP00000068487
Gene: ENSMUSG00000056429

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 58 74 N/A INTRINSIC
low complexity region 238 260 N/A INTRINSIC
transmembrane domain 300 319 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,217 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 TCT TCTACT X: 75,000,005 probably benign Het
Gab3 TTC TTCGTC X: 75,000,022 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Iqcf4 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT 9: 106,570,605 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,125 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lca5l GCCCTGGCCCTGGCCCC GCCC 16: 96,159,297 probably null Het
Lce1m CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC 3: 93,018,139 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 A AGCC X: 71,118,853 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Pdia4 CTCTTCCTCCT C 6: 47,808,306 probably null Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sbp AAGA AAGACGCTGACAACAGAGA 17: 23,945,384 probably benign Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Slc39a4 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC 15: 76,614,871 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Tgoln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Tgoln1 APN 6 72616090 missense probably benign 0.00
IGL00795:Tgoln1 APN 6 72616252 missense probably benign 0.01
IGL03002:Tgoln1 APN 6 72616072 missense possibly damaging 0.83
IGL03136:Tgoln1 APN 6 72614113 missense probably damaging 1.00
FR4340:Tgoln1 UTSW 6 72616351 small insertion probably benign
R0684:Tgoln1 UTSW 6 72615991 missense probably benign 0.00
R1656:Tgoln1 UTSW 6 72614085 missense probably damaging 0.99
R1920:Tgoln1 UTSW 6 72616101 missense probably benign 0.01
R2057:Tgoln1 UTSW 6 72615670 missense probably benign 0.35
R4097:Tgoln1 UTSW 6 72615801 missense probably damaging 0.98
R4559:Tgoln1 UTSW 6 72615681 missense probably damaging 0.98
R4995:Tgoln1 UTSW 6 72616140 missense possibly damaging 0.92
R5566:Tgoln1 UTSW 6 72616035 missense possibly damaging 0.92
R6224:Tgoln1 UTSW 6 72616001 missense possibly damaging 0.81
R6814:Tgoln1 UTSW 6 72615555 missense possibly damaging 0.90
R6872:Tgoln1 UTSW 6 72615555 missense possibly damaging 0.90
R7178:Tgoln1 UTSW 6 72616045 missense probably benign 0.01
R7339:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7342:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7347:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7348:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7366:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7368:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7491:Tgoln1 UTSW 6 72616420 missense unknown
RF003:Tgoln1 UTSW 6 72616352 nonsense probably null
RF019:Tgoln1 UTSW 6 72616069 small insertion probably benign
RF023:Tgoln1 UTSW 6 72616080 small insertion probably benign
RF028:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF030:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF030:Tgoln1 UTSW 6 72616063 small insertion probably benign
RF032:Tgoln1 UTSW 6 72616063 small insertion probably benign
RF032:Tgoln1 UTSW 6 72616074 small insertion probably benign
RF037:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF040:Tgoln1 UTSW 6 72616074 small insertion probably benign
RF043:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF043:Tgoln1 UTSW 6 72616063 small insertion probably benign
RF057:Tgoln1 UTSW 6 72616069 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCAGTGTTTCCCCAGATTCAG -3'
(R):5'- TCCAGTAAGGCGGAATCTGG -3'

Sequencing Primer
(F):5'- TCCCCAGATTCAGTTTTGGAAG -3'
(R):5'- GAATCTGGGCCGCGGAC -3'
Posted On2019-12-04