Incidental Mutation 'R0128:Lman2l'
ID 60487
Institutional Source Beutler Lab
Gene Symbol Lman2l
Ensembl Gene ENSMUSG00000001143
Gene Name lectin, mannose-binding 2-like
Synonyms A630028F14Rik, VIP36-like
MMRRC Submission 038413-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.810) question?
Stock # R0128 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 36458952-36484352 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 36463945 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 171 (S171*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001171] [ENSMUST00000115011] [ENSMUST00000123583] [ENSMUST00000125304] [ENSMUST00000140452] [ENSMUST00000179162]
AlphaFold P59481
Predicted Effect probably benign
Transcript: ENSMUST00000001171
SMART Domains Protein: ENSMUSP00000137028
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 146 1.5e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115011
AA Change: S303*
SMART Domains Protein: ENSMUSP00000110663
Gene: ENSMUSG00000001143
AA Change: S303*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 286 2e-84 PFAM
transmembrane domain 324 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123583
SMART Domains Protein: ENSMUSP00000137344
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000125304
AA Change: S292*
SMART Domains Protein: ENSMUSP00000117200
Gene: ENSMUSG00000001143
AA Change: S292*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 275 3.2e-88 PFAM
transmembrane domain 313 335 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134594
Predicted Effect probably benign
Transcript: ENSMUST00000140452
SMART Domains Protein: ENSMUSP00000144430
Gene: ENSMUSG00000037432

DomainStartEndE-ValueType
Pfam:C2 1 78 1.4e-5 PFAM
Blast:C2 148 209 3e-37 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000152088
AA Change: S92*
SMART Domains Protein: ENSMUSP00000119798
Gene: ENSMUSG00000001143
AA Change: S92*

DomainStartEndE-ValueType
Pfam:Lectin_leg-like 1 76 1.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179162
SMART Domains Protein: ENSMUSP00000142130
Gene: ENSMUSG00000037432

DomainStartEndE-ValueType
C2 1 98 2.74e-4 SMART
C2 168 264 4.29e-6 SMART
FerI 250 323 1.59e-19 SMART
C2 325 422 1.06e-5 SMART
FerA 602 669 6.26e-18 SMART
FerB 691 764 1.38e-37 SMART
internal_repeat_1 781 836 1.77e-5 PROSPERO
internal_repeat_1 852 904 1.77e-5 PROSPERO
DysFC 913 951 1.61e-3 SMART
DysFC 981 1013 4.81e-2 SMART
C2 1078 1222 1.56e0 SMART
Pfam:C2 1248 1329 1e-1 PFAM
low complexity region 1376 1387 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
C2 1487 1586 2.21e-8 SMART
C2 1659 1851 5.32e-2 SMART
transmembrane domain 1964 1986 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192969
AA Change: S171*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.6%
  • 10x: 93.0%
  • 20x: 79.3%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the L-type lectin group of type 1 membrane proteins, which function in the mammalian early secretory pathway. These proteins contain luminal carbohydrate recognition domains, which display homology to leguminous lectins. Unlike other proteins of the group, which cycle in the early secretory pathway and are predominantly associated with post endoplasmic reticulum membranes, the protein encoded by this gene is a non-cycling resident protein of the ER, where it functions as a cargo receptor for glycoproteins. It is proposed to regulate exchange of folded proteins for transport to the Golgi and exchange of misfolded glycoproteins for transport to the ubiquitin-proteasome pathway. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,602 (GRCm39) probably benign Het
Abcd4 T G 12: 84,659,126 (GRCm39) Q210P possibly damaging Het
Ablim2 G A 5: 35,966,520 (GRCm39) probably benign Het
Acte1 G T 7: 143,445,492 (GRCm39) G178C probably damaging Het
Actl6b A G 5: 137,553,327 (GRCm39) N113S probably benign Het
Actn3 A T 19: 4,921,643 (GRCm39) V179E probably damaging Het
Aff4 C A 11: 53,306,293 (GRCm39) T1145N probably damaging Het
Ankrd42 G A 7: 92,241,067 (GRCm39) Q431* probably null Het
Anxa9 A G 3: 95,209,733 (GRCm39) S129P probably benign Het
Arfgef2 T G 2: 166,677,639 (GRCm39) I88S probably damaging Het
Asap3 C A 4: 135,961,915 (GRCm39) N285K probably damaging Het
Atp6v0a2 A G 5: 124,790,248 (GRCm39) N477S probably damaging Het
Atp7b C T 8: 22,518,188 (GRCm39) E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 (GRCm39) probably null Het
C87436 G A 6: 86,446,809 (GRCm39) G533D probably damaging Het
Ccdc138 T A 10: 58,364,182 (GRCm39) I314N probably damaging Het
Ccs A G 19: 4,875,654 (GRCm39) F237S probably damaging Het
Ccz1 T G 5: 143,946,112 (GRCm39) probably benign Het
Cdcp2 C T 4: 106,963,904 (GRCm39) probably benign Het
Chd1 A G 17: 17,613,829 (GRCm39) N531S probably damaging Het
Clptm1 A T 7: 19,368,932 (GRCm39) F476I probably damaging Het
Colec12 C T 18: 9,858,921 (GRCm39) P568L unknown Het
Cped1 T A 6: 22,121,038 (GRCm39) Y373N probably benign Het
Cr2 A T 1: 194,848,539 (GRCm39) V328D probably damaging Het
D630045J12Rik A T 6: 38,126,706 (GRCm39) probably benign Het
Dcdc2a A T 13: 25,371,655 (GRCm39) probably benign Het
Dlg1 G T 16: 31,676,883 (GRCm39) probably null Het
Epb41l5 A C 1: 119,477,632 (GRCm39) V705G possibly damaging Het
Ergic3 C A 2: 155,853,060 (GRCm39) R43S possibly damaging Het
Flnb T C 14: 7,901,951 (GRCm38) V938A probably damaging Het
Frmd4a T C 2: 4,608,903 (GRCm39) Y928H probably damaging Het
Fyn C T 10: 39,387,978 (GRCm39) T78M probably benign Het
Gdap2 A G 3: 100,109,311 (GRCm39) T443A probably damaging Het
Ghrl A T 6: 113,694,129 (GRCm39) probably benign Het
Gm4787 T A 12: 81,424,521 (GRCm39) K546* probably null Het
Gm6576 C G 15: 27,026,086 (GRCm39) noncoding transcript Het
Got1 C T 19: 43,512,816 (GRCm39) D27N probably benign Het
Gucy2c C T 6: 136,681,247 (GRCm39) V946I probably damaging Het
Hectd4 T C 5: 121,487,306 (GRCm39) Y3434H possibly damaging Het
Hp1bp3 C T 4: 137,964,520 (GRCm39) S348F probably damaging Het
Itpr1 A G 6: 108,448,170 (GRCm39) probably benign Het
Kctd1 G A 18: 15,107,237 (GRCm39) P743S probably benign Het
Klhl23 T C 2: 69,664,310 (GRCm39) V553A probably damaging Het
Krt24 T C 11: 99,171,093 (GRCm39) D495G probably damaging Het
L3hypdh C T 12: 72,123,917 (GRCm39) probably null Het
Lipo3 C T 19: 33,534,506 (GRCm39) probably null Het
Lrp1b T C 2: 41,401,520 (GRCm39) D378G probably damaging Het
Map3k4 T A 17: 12,466,950 (GRCm39) D1104V probably damaging Het
Mpeg1 T C 19: 12,438,587 (GRCm39) V15A probably benign Het
Narf C T 11: 121,141,662 (GRCm39) R356C probably damaging Het
Nebl T A 2: 17,397,834 (GRCm39) Q487H possibly damaging Het
Olfm5 G A 7: 103,810,133 (GRCm39) A76V probably benign Het
Or1j11 T A 2: 36,312,299 (GRCm39) D296E probably benign Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or52p1 A T 7: 104,267,788 (GRCm39) I301F probably damaging Het
Or5ak22 T A 2: 85,230,305 (GRCm39) S191C probably damaging Het
Or8k40 T C 2: 86,584,231 (GRCm39) M284V probably benign Het
Palb2 A T 7: 121,727,389 (GRCm39) Y160* probably null Het
Pasd1 T C X: 70,983,161 (GRCm39) C378R possibly damaging Het
Paxip1 C T 5: 27,949,183 (GRCm39) probably benign Het
Pclo A G 5: 14,729,811 (GRCm39) probably benign Het
Pdcd11 G A 19: 47,108,301 (GRCm39) V1223I probably benign Het
Pde6c T C 19: 38,157,813 (GRCm39) probably benign Het
Prr12 A G 7: 44,699,463 (GRCm39) probably benign Het
Prss39 T A 1: 34,541,281 (GRCm39) probably benign Het
Samd5 A G 10: 9,550,683 (GRCm39) W9R probably damaging Het
Sfr1 A G 19: 47,723,457 (GRCm39) *320W probably null Het
Sft2d1rt A G 11: 45,943,120 (GRCm39) M1T probably null Het
Sh3bp4 A G 1: 89,073,036 (GRCm39) N628S possibly damaging Het
Sim1 A T 10: 50,784,057 (GRCm39) I104F probably damaging Het
Slc1a3 T C 15: 8,665,693 (GRCm39) M519V probably benign Het
Smcp T A 3: 92,491,827 (GRCm39) T7S unknown Het
Sp4 A G 12: 118,264,551 (GRCm39) probably benign Het
Spag9 T A 11: 93,984,365 (GRCm39) I327N probably damaging Het
Thbs4 G T 13: 92,890,918 (GRCm39) H850N probably benign Het
Ubap2l A T 3: 89,928,680 (GRCm39) S478T possibly damaging Het
Unc79 A G 12: 103,054,693 (GRCm39) probably benign Het
Vmn2r85 A G 10: 130,255,054 (GRCm39) probably benign Het
Wrap73 A G 4: 154,226,957 (GRCm39) D19G possibly damaging Het
Other mutations in Lman2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Lman2l APN 1 36,477,915 (GRCm39) critical splice acceptor site probably null
IGL02301:Lman2l APN 1 36,482,624 (GRCm39) missense probably damaging 1.00
IGL03288:Lman2l APN 1 36,482,628 (GRCm39) missense probably damaging 0.98
IGL03295:Lman2l APN 1 36,477,892 (GRCm39) missense probably damaging 1.00
R0130:Lman2l UTSW 1 36,463,945 (GRCm39) nonsense probably null
R0981:Lman2l UTSW 1 36,484,314 (GRCm39) start codon destroyed unknown
R2010:Lman2l UTSW 1 36,484,262 (GRCm39) nonsense probably null
R2039:Lman2l UTSW 1 36,467,535 (GRCm39) missense probably damaging 1.00
R2343:Lman2l UTSW 1 36,467,190 (GRCm39) missense possibly damaging 0.90
R4195:Lman2l UTSW 1 36,464,022 (GRCm39) missense probably damaging 0.98
R4394:Lman2l UTSW 1 36,478,804 (GRCm39) missense probably damaging 1.00
R4526:Lman2l UTSW 1 36,477,844 (GRCm39) missense probably damaging 0.98
R5747:Lman2l UTSW 1 36,464,038 (GRCm39) missense possibly damaging 0.90
R6156:Lman2l UTSW 1 36,477,907 (GRCm39) missense probably damaging 1.00
R6264:Lman2l UTSW 1 36,477,850 (GRCm39) missense probably damaging 1.00
R7013:Lman2l UTSW 1 36,482,599 (GRCm39) unclassified probably benign
R9189:Lman2l UTSW 1 36,478,771 (GRCm39) missense probably damaging 1.00
R9356:Lman2l UTSW 1 36,467,415 (GRCm39) missense probably damaging 1.00
R9577:Lman2l UTSW 1 36,467,490 (GRCm39) missense probably damaging 1.00
Z1176:Lman2l UTSW 1 36,467,457 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTGACACCCACTTCTGAGGAAC -3'
(R):5'- AAAGTCGTCTTCCTGTCACTGCTG -3'

Sequencing Primer
(F):5'- CTTTGCCTGTAACAGGACAGATG -3'
(R):5'- TCACTGCTGTCAGTCAAGAG -3'
Posted On 2013-07-24