Mutagenetix > Incidental Mutation

Incidental Mutation 'R0128:Lman2l'

60487

Institutional Source

Beutler Lab

Gene Symbol

Lman2l

Ensembl Gene

ENSMUSG00000001143

Gene Name

lectin, mannose-binding 2-like

Synonyms

A630028F14Rik, VIP36-like

MMRRC Submission

038413-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.763) question?

Stock #

R0128 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36419871-36445271 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 36424864 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 171 (S171*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001171] [ENSMUST00000115011] [ENSMUST00000123583] [ENSMUST00000125304] [ENSMUST00000140452] [ENSMUST00000179162]

AlphaFold

P59481

Predicted Effect

probably benign
Transcript: ENSMUST00000001171

SMART Domains

Protein: ENSMUSP00000137028
Gene: ENSMUSG00000001143

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Lectin_leg-like	48	146	1.5e-34	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000115011
AA Change: S303*

SMART Domains

Protein: ENSMUSP00000110663
Gene: ENSMUSG00000001143
AA Change: S303*

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Lectin_leg-like	48	286	2e-84	PFAM
transmembrane domain	324	346	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123583

SMART Domains

Protein: ENSMUSP00000137344
Gene: ENSMUSG00000001143

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000125304
AA Change: S292*

SMART Domains

Protein: ENSMUSP00000117200
Gene: ENSMUSG00000001143
AA Change: S292*

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Lectin_leg-like	48	275	3.2e-88	PFAM
transmembrane domain	313	335	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134594

Predicted Effect

probably benign
Transcript: ENSMUST00000140452

SMART Domains

Protein: ENSMUSP00000144430
Gene: ENSMUSG00000037432

Domain	Start	End	E-Value	Type
Pfam:C2	1	78	1.4e-5	PFAM
Blast:C2	148	209	3e-37	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000152088
AA Change: S92*

SMART Domains

Protein: ENSMUSP00000119798
Gene: ENSMUSG00000001143
AA Change: S92*

Domain	Start	End	E-Value	Type
Pfam:Lectin_leg-like	1	76	1.3e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179162

SMART Domains

Protein: ENSMUSP00000142130
Gene: ENSMUSG00000037432

Domain	Start	End	E-Value	Type
C2	1	98	2.74e-4	SMART
C2	168	264	4.29e-6	SMART
FerI	250	323	1.59e-19	SMART
C2	325	422	1.06e-5	SMART
FerA	602	669	6.26e-18	SMART
FerB	691	764	1.38e-37	SMART
internal_repeat_1	781	836	1.77e-5	PROSPERO
internal_repeat_1	852	904	1.77e-5	PROSPERO
DysFC	913	951	1.61e-3	SMART
DysFC	981	1013	4.81e-2	SMART
C2	1078	1222	1.56e0	SMART
Pfam:C2	1248	1329	1e-1	PFAM
low complexity region	1376	1387	N/A	INTRINSIC
low complexity region	1459	1470	N/A	INTRINSIC
C2	1487	1586	2.21e-8	SMART
C2	1659	1851	5.32e-2	SMART
transmembrane domain	1964	1986	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000192969
AA Change: S171*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 97.6%
10x: 93.0%
20x: 79.3%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the L-type lectin group of type 1 membrane proteins, which function in the mammalian early secretory pathway. These proteins contain luminal carbohydrate recognition domains, which display homology to leguminous lectins. Unlike other proteins of the group, which cycle in the early secretory pathway and are predominantly associated with post endoplasmic reticulum membranes, the protein encoded by this gene is a non-cycling resident protein of the ER, where it functions as a cargo receptor for glycoproteins. It is proposed to regulate exchange of folded proteins for transport to the Golgi and exchange of misfolded glycoproteins for transport to the ubiquitin-proteasome pathway. [provided by RefSeq, Apr 2016]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	G	6: 128,575,639		probably benign	Het
Abcd4	T	G	12: 84,612,352	Q210P	possibly damaging	Het
Ablim2	G	A	5: 35,809,176		probably benign	Het
Actl6b	A	G	5: 137,555,065	N113S	probably benign	Het
Actn3	A	T	19: 4,871,615	V179E	probably damaging	Het
Aff4	C	A	11: 53,415,466	T1145N	probably damaging	Het
Ankrd42	G	A	7: 92,591,859	Q431*	probably null	Het
Anxa9	A	G	3: 95,302,422	S129P	probably benign	Het
Arfgef2	T	G	2: 166,835,719	I88S	probably damaging	Het
Asap3	C	A	4: 136,234,604	N285K	probably damaging	Het
Atp6v0a2	A	G	5: 124,713,184	N477S	probably damaging	Het
Atp7b	C	T	8: 22,028,172	E205K	possibly damaging	Het
Atp8b5	T	A	4: 43,369,715		probably null	Het
C87436	G	A	6: 86,469,827	G533D	probably damaging	Het
Ccdc138	T	A	10: 58,528,360	I314N	probably damaging	Het
Ccs	A	G	19: 4,825,626	F237S	probably damaging	Het
Ccz1	T	G	5: 144,009,294		probably benign	Het
Cdcp2	C	T	4: 107,106,707		probably benign	Het
Chd1	A	G	17: 17,393,567	N531S	probably damaging	Het
Clptm1	A	T	7: 19,635,007	F476I	probably damaging	Het
Colec12	C	T	18: 9,858,921	P568L	unknown	Het
Cped1	T	A	6: 22,121,039	Y373N	probably benign	Het
Cr2	A	T	1: 195,166,231	V328D	probably damaging	Het
D630045J12Rik	A	T	6: 38,149,771		probably benign	Het
Dcdc2a	A	T	13: 25,187,672		probably benign	Het
Dlg1	G	T	16: 31,858,065		probably null	Het
Epb41l5	A	C	1: 119,549,902	V705G	possibly damaging	Het
Ergic3	C	A	2: 156,011,140	R43S	possibly damaging	Het
Flnb	T	C	14: 7,901,951	V938A	probably damaging	Het
Frmd4a	T	C	2: 4,604,092	Y928H	probably damaging	Het
Fyn	C	T	10: 39,511,982	T78M	probably benign	Het
Gdap2	A	G	3: 100,201,995	T443A	probably damaging	Het
Ghrl	A	T	6: 113,717,168		probably benign	Het
Gm1141	T	C	X: 71,939,555	C378R	possibly damaging	Het
Gm12166	A	G	11: 46,052,293	M1T	probably null	Het
Gm4787	T	A	12: 81,377,747	K546*	probably null	Het
Gm498	G	T	7: 143,891,755	G178C	probably damaging	Het
Gm6576	C	G	15: 27,026,000		noncoding transcript	Het
Got1	C	T	19: 43,524,377	D27N	probably benign	Het
Gucy2c	C	T	6: 136,704,249	V946I	probably damaging	Het
Hectd4	T	C	5: 121,349,243	Y3434H	possibly damaging	Het
Hp1bp3	C	T	4: 138,237,209	S348F	probably damaging	Het
Itpr1	A	G	6: 108,471,209		probably benign	Het
Kctd1	G	A	18: 14,974,180	P743S	probably benign	Het
Klhl23	T	C	2: 69,833,966	V553A	probably damaging	Het
Krt24	T	C	11: 99,280,267	D495G	probably damaging	Het
L3hypdh	C	T	12: 72,077,143		probably null	Het
Lipo3	C	T	19: 33,557,106		probably null	Het
Lrp1b	T	C	2: 41,511,508	D378G	probably damaging	Het
Map3k4	T	A	17: 12,248,063	D1104V	probably damaging	Het
Mpeg1	T	C	19: 12,461,223	V15A	probably benign	Het
Narf	C	T	11: 121,250,836	R356C	probably damaging	Het
Nebl	T	A	2: 17,393,023	Q487H	possibly damaging	Het
Olfm5	G	A	7: 104,160,926	A76V	probably benign	Het
Olfr1090	T	C	2: 86,753,887	M284V	probably benign	Het
Olfr339	T	A	2: 36,422,287	D296E	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr656	A	T	7: 104,618,581	I301F	probably damaging	Het
Olfr992	T	A	2: 85,399,961	S191C	probably damaging	Het
Palb2	A	T	7: 122,128,166	Y160*	probably null	Het
Paxip1	C	T	5: 27,744,185		probably benign	Het
Pclo	A	G	5: 14,679,797		probably benign	Het
Pdcd11	G	A	19: 47,119,862	V1223I	probably benign	Het
Pde6c	T	C	19: 38,169,365		probably benign	Het
Prr12	A	G	7: 45,050,039		probably benign	Het
Prss39	T	A	1: 34,502,200		probably benign	Het
Samd5	A	G	10: 9,674,939	W9R	probably damaging	Het
Sfr1	A	G	19: 47,735,018	*320W	probably null	Het
Sh3bp4	A	G	1: 89,145,314	N628S	possibly damaging	Het
Sim1	A	T	10: 50,907,961	I104F	probably damaging	Het
Slc1a3	T	C	15: 8,636,209	M519V	probably benign	Het
Smcp	T	A	3: 92,584,520	T7S	unknown	Het
Sp4	A	G	12: 118,300,816		probably benign	Het
Spag9	T	A	11: 94,093,539	I327N	probably damaging	Het
Thbs4	G	T	13: 92,754,410	H850N	probably benign	Het
Ubap2l	A	T	3: 90,021,373	S478T	possibly damaging	Het
Unc79	A	G	12: 103,088,434		probably benign	Het
Vmn2r85	A	G	10: 130,419,185		probably benign	Het
Wrap73	A	G	4: 154,142,500	D19G	possibly damaging	Het

Other mutations in Lman2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Lman2l	APN	1	36438834	critical splice acceptor site	probably null
IGL02301:Lman2l	APN	1	36443543	missense	probably damaging	1.00
IGL03288:Lman2l	APN	1	36443547	missense	probably damaging	0.98
IGL03295:Lman2l	APN	1	36438811	missense	probably damaging	1.00
R0130:Lman2l	UTSW	1	36424864	nonsense	probably null
R0981:Lman2l	UTSW	1	36445233	start codon destroyed	unknown
R2010:Lman2l	UTSW	1	36445181	nonsense	probably null
R2039:Lman2l	UTSW	1	36428454	missense	probably damaging	1.00
R2343:Lman2l	UTSW	1	36428109	missense	possibly damaging	0.90
R4195:Lman2l	UTSW	1	36424941	missense	probably damaging	0.98
R4394:Lman2l	UTSW	1	36439723	missense	probably damaging	1.00
R4526:Lman2l	UTSW	1	36438763	missense	probably damaging	0.98
R5747:Lman2l	UTSW	1	36424957	missense	possibly damaging	0.90
R6156:Lman2l	UTSW	1	36438826	missense	probably damaging	1.00
R6264:Lman2l	UTSW	1	36438769	missense	probably damaging	1.00
R7013:Lman2l	UTSW	1	36443518	unclassified	probably benign
R9189:Lman2l	UTSW	1	36439690	missense	probably damaging	1.00
R9356:Lman2l	UTSW	1	36428334	missense	probably damaging	1.00
R9577:Lman2l	UTSW	1	36428409	missense	probably damaging	1.00
Z1176:Lman2l	UTSW	1	36428376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCTGACACCCACTTCTGAGGAAC -3'
(R):5'- AAAGTCGTCTTCCTGTCACTGCTG -3'

Sequencing Primer
(F):5'- CTTTGCCTGTAACAGGACAGATG -3'
(R):5'- TCACTGCTGTCAGTCAAGAG -3'

Posted On

2013-07-24