Incidental Mutation 'RF042:Tsen2'
ID604870
Institutional Source Beutler Lab
Gene Symbol Tsen2
Ensembl Gene ENSMUSG00000042389
Gene NametRNA splicing endonuclease subunit 2
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #RF042 (G1)
Quality Score213.468
Status Not validated
Chromosome6
Chromosomal Location115544664-115578628 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GGA to GGATGA at 115560067 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040234]
Predicted Effect probably benign
Transcript: ENSMUST00000040234
SMART Domains Protein: ENSMUSP00000038211
Gene: ENSMUSG00000042389

DomainStartEndE-ValueType
Blast:HOLI 1 55 2e-23 BLAST
Pfam:tRNA_int_endo_N 258 324 9.9e-16 PFAM
Pfam:tRNA_int_endo 334 426 5.2e-21 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the tRNA splicing endonuclease. This endonuclease catalyzes the first step in RNA splicing which is the removal of introns. Mutations in this gene have been associated with pontocerebellar hypoplasia type 2. A pseudogene has been identified on chromosome 4. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,217 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 TCT TCTACT X: 75,000,005 probably benign Het
Gab3 TTC TTCGTC X: 75,000,022 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Iqcf4 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT 9: 106,570,605 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,125 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lca5l GCCCTGGCCCTGGCCCC GCCC 16: 96,159,297 probably null Het
Lce1m CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC 3: 93,018,139 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 A AGCC X: 71,118,853 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Pdia4 CTCTTCCTCCT C 6: 47,808,306 probably null Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sbp AAGA AAGACGCTGACAACAGAGA 17: 23,945,384 probably benign Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Slc39a4 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC 15: 76,614,871 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Tsen2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Tsen2 APN 6 115576984 missense probably damaging 1.00
IGL01409:Tsen2 APN 6 115559594 missense possibly damaging 0.72
IGL02002:Tsen2 APN 6 115559607 missense probably benign 0.12
IGL03301:Tsen2 APN 6 115568771 missense probably damaging 1.00
FR4304:Tsen2 UTSW 6 115560069 small insertion probably benign
FR4340:Tsen2 UTSW 6 115560066 small insertion probably benign
FR4340:Tsen2 UTSW 6 115560069 small insertion probably benign
FR4342:Tsen2 UTSW 6 115560072 small insertion probably benign
FR4548:Tsen2 UTSW 6 115560068 small insertion probably benign
FR4737:Tsen2 UTSW 6 115560077 small insertion probably benign
FR4976:Tsen2 UTSW 6 115560066 small insertion probably benign
R0141:Tsen2 UTSW 6 115568829 missense probably damaging 0.99
R1165:Tsen2 UTSW 6 115561435 missense probably damaging 1.00
R1528:Tsen2 UTSW 6 115560028 missense probably benign 0.01
R2152:Tsen2 UTSW 6 115547975 missense possibly damaging 0.94
R4022:Tsen2 UTSW 6 115547987 missense probably damaging 1.00
R4246:Tsen2 UTSW 6 115547824 splice site probably benign
R4247:Tsen2 UTSW 6 115547824 splice site probably benign
R4249:Tsen2 UTSW 6 115547824 splice site probably benign
R4774:Tsen2 UTSW 6 115575933 missense possibly damaging 0.92
R5511:Tsen2 UTSW 6 115561404 missense probably damaging 1.00
R5580:Tsen2 UTSW 6 115577980 missense probably damaging 1.00
R5935:Tsen2 UTSW 6 115559595 missense probably damaging 1.00
R6086:Tsen2 UTSW 6 115560075 missense probably benign 0.35
R6457:Tsen2 UTSW 6 115559631 missense probably benign 0.01
R6750:Tsen2 UTSW 6 115549920 missense probably damaging 1.00
R7009:Tsen2 UTSW 6 115547972 missense possibly damaging 0.94
R7438:Tsen2 UTSW 6 115559982 nonsense probably null
RF030:Tsen2 UTSW 6 115560067 small insertion probably benign
RF035:Tsen2 UTSW 6 115560067 small insertion probably benign
RF056:Tsen2 UTSW 6 115560064 small insertion probably benign
Z1176:Tsen2 UTSW 6 115559916 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGACAGTCAGATGACCTACCC -3'
(R):5'- TCCTAACACTGCAATGAGAGC -3'

Sequencing Primer
(F):5'- GTCTCGGCACACACTCAG -3'
(R):5'- GCAATAAGGAATGTGGGCTCTC -3'
Posted On2019-12-04