Incidental Mutation 'RF042:Iqcf4'
ID604878
Institutional Source Beutler Lab
Gene Symbol Iqcf4
Ensembl Gene ENSMUSG00000041009
Gene NameIQ motif containing F4
Synonyms1700042N06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #RF042 (G1)
Quality Score176.468
Status Not validated
Chromosome9
Chromosomal Location106568319-106570996 bp(-) (GRCm38)
Type of Mutationsmall insertion (12 aa in frame mutation)
DNA Base Change (assembly) TCCTTTTCCTTTTCCTTTT to TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT at 106570605 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000082192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085111]
Predicted Effect probably benign
Transcript: ENSMUST00000085111
SMART Domains Protein: ENSMUSP00000082192
Gene: ENSMUSG00000041009

DomainStartEndE-ValueType
coiled coil region 14 41 N/A INTRINSIC
IQ 66 88 2.72e-3 SMART
IQ 89 111 2.32e2 SMART
IQ 122 144 9.33e-2 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,217 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 TCT TCTACT X: 75,000,005 probably benign Het
Gab3 TTC TTCGTC X: 75,000,022 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,125 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lca5l GCCCTGGCCCTGGCCCC GCCC 16: 96,159,297 probably null Het
Lce1m CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC 3: 93,018,139 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 A AGCC X: 71,118,853 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Pdia4 CTCTTCCTCCT C 6: 47,808,306 probably null Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sbp AAGA AAGACGCTGACAACAGAGA 17: 23,945,384 probably benign Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Slc39a4 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC 15: 76,614,871 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Iqcf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Iqcf4 APN 9 106570633 missense probably benign 0.12
R0781:Iqcf4 UTSW 9 106568661 missense probably benign 0.06
R1764:Iqcf4 UTSW 9 106568694 missense probably benign 0.12
R4525:Iqcf4 UTSW 9 106570628 missense possibly damaging 0.51
R4703:Iqcf4 UTSW 9 106568320 splice site probably null
R5823:Iqcf4 UTSW 9 106568601 missense probably benign 0.00
R6298:Iqcf4 UTSW 9 106568675 missense probably benign 0.25
R7773:Iqcf4 UTSW 9 106568613 missense probably benign 0.08
R7780:Iqcf4 UTSW 9 106568661 missense possibly damaging 0.93
R7818:Iqcf4 UTSW 9 106570539 nonsense probably null
RF003:Iqcf4 UTSW 9 106570607 small insertion probably benign
RF007:Iqcf4 UTSW 9 106570609 small insertion probably benign
RF016:Iqcf4 UTSW 9 106570609 small insertion probably benign
RF028:Iqcf4 UTSW 9 106570614 small insertion probably benign
RF031:Iqcf4 UTSW 9 106570615 small insertion probably benign
RF036:Iqcf4 UTSW 9 106570611 small insertion probably benign
RF041:Iqcf4 UTSW 9 106570613 nonsense probably null
RF043:Iqcf4 UTSW 9 106570613 small insertion probably benign
RF045:Iqcf4 UTSW 9 106570610 small insertion probably benign
RF046:Iqcf4 UTSW 9 106570610 small insertion probably benign
RF047:Iqcf4 UTSW 9 106570612 small insertion probably benign
RF063:Iqcf4 UTSW 9 106570617 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGCTCACACAAGTCTGTTTGG -3'
(R):5'- TTGACAGAGATAAGTCCAGCATC -3'

Sequencing Primer
(F):5'- GGTGCATACATTCCATGACCG -3'
(R):5'- GTCCAGCATCTAGGGATACTG -3'
Posted On2019-12-04