Incidental Mutation 'RF042:Tob1'
ID604880
Institutional Source Beutler Lab
Gene Symbol Tob1
Ensembl Gene ENSMUSG00000037573
Gene Nametransducer of ErbB-2.1
SynonymsTrob, Tob
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF042 (G1)
Quality Score180.468
Status Not validated
Chromosome11
Chromosomal Location94211454-94215495 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CACA to CACAACA at 94214451 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041589]
Predicted Effect probably benign
Transcript: ENSMUST00000041589
SMART Domains Protein: ENSMUSP00000036039
Gene: ENSMUSG00000037573

DomainStartEndE-ValueType
btg1 1 106 2.41e-77 SMART
low complexity region 141 160 N/A INTRINSIC
low complexity region 176 187 N/A INTRINSIC
low complexity region 238 280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transducer of erbB-2 /B-cell translocation gene protein family. Members of this family are anti-proliferative factors that have the potential to regulate cell growth. The encoded protein may function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable and exhibit increased bone mass due to increased osteoblast proliferation and differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,217 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 TCT TCTACT X: 75,000,005 probably benign Het
Gab3 TTC TTCGTC X: 75,000,022 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Iqcf4 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT 9: 106,570,605 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,125 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lca5l GCCCTGGCCCTGGCCCC GCCC 16: 96,159,297 probably null Het
Lce1m CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC 3: 93,018,139 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 A AGCC X: 71,118,853 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Pdia4 CTCTTCCTCCT C 6: 47,808,306 probably null Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sbp AAGA AAGACGCTGACAACAGAGA 17: 23,945,384 probably benign Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Slc39a4 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC 15: 76,614,871 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Tob1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Tob1 APN 11 94214055 missense probably damaging 1.00
IGL02028:Tob1 APN 11 94214226 missense probably benign 0.43
IGL02866:Tob1 APN 11 94214057 missense possibly damaging 0.87
FR4304:Tob1 UTSW 11 94214464 small insertion probably benign
FR4304:Tob1 UTSW 11 94214477 nonsense probably null
FR4340:Tob1 UTSW 11 94214454 small insertion probably benign
FR4340:Tob1 UTSW 11 94214460 small insertion probably benign
FR4340:Tob1 UTSW 11 94214477 small insertion probably benign
FR4342:Tob1 UTSW 11 94214472 small insertion probably benign
FR4449:Tob1 UTSW 11 94214468 small insertion probably benign
FR4449:Tob1 UTSW 11 94214475 small insertion probably benign
FR4548:Tob1 UTSW 11 94214455 small insertion probably benign
FR4548:Tob1 UTSW 11 94214469 small insertion probably benign
FR4589:Tob1 UTSW 11 94214451 small insertion probably benign
FR4589:Tob1 UTSW 11 94214477 frame shift probably null
FR4737:Tob1 UTSW 11 94214451 small insertion probably benign
FR4737:Tob1 UTSW 11 94214464 small insertion probably benign
FR4737:Tob1 UTSW 11 94214478 small insertion probably benign
FR4976:Tob1 UTSW 11 94214472 small insertion probably benign
R0142:Tob1 UTSW 11 94214597 missense probably damaging 1.00
R1777:Tob1 UTSW 11 94213754 missense probably damaging 1.00
R4213:Tob1 UTSW 11 94214192 missense probably damaging 1.00
R4280:Tob1 UTSW 11 94214322 missense probably benign
R4537:Tob1 UTSW 11 94214452 small deletion probably benign
R4899:Tob1 UTSW 11 94214452 small deletion probably benign
R5074:Tob1 UTSW 11 94213741 missense possibly damaging 0.88
R5502:Tob1 UTSW 11 94214452 small deletion probably benign
R5828:Tob1 UTSW 11 94213757 missense probably damaging 1.00
R5828:Tob1 UTSW 11 94213759 nonsense probably null
R7471:Tob1 UTSW 11 94213882 missense probably benign 0.45
R7839:Tob1 UTSW 11 94213772 missense probably damaging 1.00
R7922:Tob1 UTSW 11 94213772 missense probably damaging 1.00
RF028:Tob1 UTSW 11 94214451 small insertion probably benign
RF041:Tob1 UTSW 11 94214451 small insertion probably benign
RF044:Tob1 UTSW 11 94214461 small insertion probably benign
RF054:Tob1 UTSW 11 94214461 small insertion probably benign
Z1177:Tob1 UTSW 11 94213992 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ACTTCTCCGATCAACCTGGG -3'
(R):5'- AGACTTCTCGTTGAGGCCTC -3'

Sequencing Primer
(F):5'- TCAACCTGGGCCTGACTGTAAATG -3'
(R):5'- TCTCGTTGAGGCCTCCGTAG -3'
Posted On2019-12-04