Incidental Mutation 'RF042:Cntnap1'
ID604881
Institutional Source Beutler Lab
Gene Symbol Cntnap1
Ensembl Gene ENSMUSG00000017167
Gene Namecontactin associated protein-like 1
SynonymsNrxn4, Caspr, NCP1, p190, paranodin, shm
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #RF042 (G1)
Quality Score145.467
Status Not validated
Chromosome11
Chromosomal Location101170523-101190724 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) TTT to TTTTGTT at 101180305 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062759] [ENSMUST00000103109]
Predicted Effect probably benign
Transcript: ENSMUST00000062759
SMART Domains Protein: ENSMUSP00000062588
Gene: ENSMUSG00000044052

DomainStartEndE-ValueType
Pfam:7tm_1 58 310 4.8e-43 PFAM
low complexity region 313 329 N/A INTRINSIC
low complexity region 336 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103109
SMART Domains Protein: ENSMUSP00000099398
Gene: ENSMUSG00000017167

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FA58C 25 169 7.49e-36 SMART
LamG 196 333 2.86e-32 SMART
LamG 382 516 3.49e-27 SMART
EGF 544 578 2.28e0 SMART
Blast:FBG 580 777 1e-133 BLAST
LamG 806 940 1.95e-25 SMART
EGF_like 961 997 6.03e1 SMART
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1047 1058 N/A INTRINSIC
low complexity region 1063 1078 N/A INTRINSIC
LamG 1081 1219 2.59e-30 SMART
4.1m 1305 1323 7.85e-7 SMART
low complexity region 1333 1370 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene product was initially identified as a 190-kD protein associated with the contactin-PTPRZ1 complex. The 1,384-amino acid protein, also designated p190 or CASPR for 'contactin-associated protein,' includes an extracellular domain with several putative protein-protein interaction domains, a putative transmembrane domain, and a 74-amino acid cytoplasmic domain. Northern blot analysis showed that the gene is transcribed predominantly in brain as a transcript of 6.2 kb, with weak expression in several other tissues tested. The architecture of its extracellular domain is similar to that of neurexins, and this protein may be the signaling subunit of contactin, enabling recruitment and activation of intracellular signaling pathways in neurons. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit reduced body size and nervous system defects, including impaired balance, hypoactivity, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,217 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 TCT TCTACT X: 75,000,005 probably benign Het
Gab3 TTC TTCGTC X: 75,000,022 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Iqcf4 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT 9: 106,570,605 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,125 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lca5l GCCCTGGCCCTGGCCCC GCCC 16: 96,159,297 probably null Het
Lce1m CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC 3: 93,018,139 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 A AGCC X: 71,118,853 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Pdia4 CTCTTCCTCCT C 6: 47,808,306 probably null Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sbp AAGA AAGACGCTGACAACAGAGA 17: 23,945,384 probably benign Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Slc39a4 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC 15: 76,614,871 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Cntnap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Cntnap1 APN 11 101185092 missense possibly damaging 0.63
IGL00715:Cntnap1 APN 11 101183205 splice site probably benign
IGL00792:Cntnap1 APN 11 101178966 missense probably benign 0.19
IGL01063:Cntnap1 APN 11 101181788 missense probably benign 0.00
IGL01141:Cntnap1 APN 11 101178807 splice site probably benign
IGL02184:Cntnap1 APN 11 101178365 missense probably damaging 0.98
IGL02272:Cntnap1 APN 11 101178316 missense probably damaging 0.99
IGL02281:Cntnap1 APN 11 101182254 missense possibly damaging 0.86
IGL02437:Cntnap1 APN 11 101186851 missense probably damaging 1.00
IGL02456:Cntnap1 APN 11 101178129 missense probably benign 0.31
IGL02966:Cntnap1 APN 11 101184749 missense probably damaging 1.00
IGL03126:Cntnap1 APN 11 101176301 missense probably benign 0.00
IGL03294:Cntnap1 APN 11 101181682 missense possibly damaging 0.94
Penny UTSW 11 101186764 missense probably damaging 0.99
FR4304:Cntnap1 UTSW 11 101189581 unclassified probably benign
FR4304:Cntnap1 UTSW 11 101189589 unclassified probably benign
FR4342:Cntnap1 UTSW 11 101189575 unclassified probably benign
FR4449:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4449:Cntnap1 UTSW 11 101189593 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189572 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189579 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189593 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189594 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189566 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189575 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189580 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189581 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189576 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189582 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189590 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189572 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189585 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189588 unclassified probably benign
PIT4354001:Cntnap1 UTSW 11 101181297 missense probably damaging 1.00
PIT4466001:Cntnap1 UTSW 11 101177305 missense probably benign
R0329:Cntnap1 UTSW 11 101188309 missense probably damaging 1.00
R0556:Cntnap1 UTSW 11 101183996 missense probably benign
R0586:Cntnap1 UTSW 11 101187014 missense probably damaging 0.97
R0635:Cntnap1 UTSW 11 101183459 missense probably benign 0.05
R0789:Cntnap1 UTSW 11 101181384 splice site probably benign
R1016:Cntnap1 UTSW 11 101177507 missense probably damaging 0.99
R1085:Cntnap1 UTSW 11 101178836 missense probably benign 0.02
R1211:Cntnap1 UTSW 11 101184710 missense probably damaging 1.00
R1466:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1466:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1584:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1689:Cntnap1 UTSW 11 101188873 unclassified probably null
R1758:Cntnap1 UTSW 11 101184623 missense probably damaging 1.00
R1779:Cntnap1 UTSW 11 101186511 missense probably damaging 0.99
R1964:Cntnap1 UTSW 11 101178024 nonsense probably null
R1966:Cntnap1 UTSW 11 101180386 missense possibly damaging 0.89
R2070:Cntnap1 UTSW 11 101182979 missense probably damaging 1.00
R2088:Cntnap1 UTSW 11 101182547 missense probably damaging 1.00
R2118:Cntnap1 UTSW 11 101188657 missense probably benign
R3795:Cntnap1 UTSW 11 101186764 missense probably damaging 0.99
R4375:Cntnap1 UTSW 11 101182253 missense probably damaging 1.00
R4779:Cntnap1 UTSW 11 101178072 missense possibly damaging 0.91
R4832:Cntnap1 UTSW 11 101183019 missense probably damaging 1.00
R4965:Cntnap1 UTSW 11 101177425 missense possibly damaging 0.52
R4981:Cntnap1 UTSW 11 101176333 splice site probably null
R5008:Cntnap1 UTSW 11 101188741 nonsense probably null
R5399:Cntnap1 UTSW 11 101183316 missense probably benign
R5507:Cntnap1 UTSW 11 101183477 missense probably benign 0.42
R5560:Cntnap1 UTSW 11 101182435 missense probably damaging 1.00
R5589:Cntnap1 UTSW 11 101185118 missense probably benign
R6038:Cntnap1 UTSW 11 101184636 missense probably benign 0.12
R6038:Cntnap1 UTSW 11 101184636 missense probably benign 0.12
R6242:Cntnap1 UTSW 11 101182538 missense probably damaging 1.00
R6306:Cntnap1 UTSW 11 101184615 missense probably damaging 1.00
R6392:Cntnap1 UTSW 11 101186646 missense probably damaging 1.00
R6803:Cntnap1 UTSW 11 101177234 missense possibly damaging 0.81
R6939:Cntnap1 UTSW 11 101186511 missense probably damaging 0.99
R6944:Cntnap1 UTSW 11 101182904 missense probably damaging 0.97
R7152:Cntnap1 UTSW 11 101177326 missense probably damaging 1.00
R7297:Cntnap1 UTSW 11 101188634 missense probably benign 0.01
R7347:Cntnap1 UTSW 11 101185268 missense probably damaging 1.00
R7961:Cntnap1 UTSW 11 101178295 missense probably benign
R7980:Cntnap1 UTSW 11 101188893 missense probably benign
R8307:Cntnap1 UTSW 11 101188876 missense possibly damaging 0.73
R8386:Cntnap1 UTSW 11 101182203 missense probably damaging 1.00
RF048:Cntnap1 UTSW 11 101180305 critical splice acceptor site probably benign
RF048:Cntnap1 UTSW 11 101189563 unclassified probably benign
RF049:Cntnap1 UTSW 11 101189592 unclassified probably benign
RF049:Cntnap1 UTSW 11 101189596 unclassified probably benign
RF050:Cntnap1 UTSW 11 101189592 unclassified probably benign
Z1176:Cntnap1 UTSW 11 101182898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTATGGACATTGGGATTAGCAAC -3'
(R):5'- TGCCCTTCGCTAAGCATCAG -3'

Sequencing Primer
(F):5'- CATTGGGATTAGCAACAAAAAGC -3'
(R):5'- TCAGCTCCACATGACCCAG -3'
Posted On2019-12-04