Incidental Mutation 'RF042:Slc39a4'
ID604883
Institutional Source Beutler Lab
Gene Symbol Slc39a4
Ensembl Gene ENSMUSG00000063354
Gene Namesolute carrier family 39 (zinc transporter), member 4
SynonymsAWMS2, zip4, 1600025H15Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF042 (G1)
Quality Score217.468
Status Not validated
Chromosome15
Chromosomal Location76612383-76617384 bp(-) (GRCm38)
Type of Mutationsmall insertion (12 aa in frame mutation)
DNA Base Change (assembly) TC to TCATCATGATCACCATGGTCACCATGATCACTGTGGCC at 76614871 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073428] [ENSMUST00000230977]
Predicted Effect probably benign
Transcript: ENSMUST00000073428
SMART Domains Protein: ENSMUSP00000073134
Gene: ENSMUSG00000063354

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
Pfam:Zip 335 652 3.5e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230977
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc/iron-regulated transporter-like protein (ZIP) family. The encoded protein localizes to cell membranes and is required for zinc uptake in the intestine. Mutations in this gene result in acrodermatitis enteropathica. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic letahlity around E10. Mice heterozygous for a null allele exhibit developmental defects similar to the teratology of zinc deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,217 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 TCT TCTACT X: 75,000,005 probably benign Het
Gab3 TTC TTCGTC X: 75,000,022 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Iqcf4 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT 9: 106,570,605 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,125 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lca5l GCCCTGGCCCTGGCCCC GCCC 16: 96,159,297 probably null Het
Lce1m CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC 3: 93,018,139 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 A AGCC X: 71,118,853 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Pdia4 CTCTTCCTCCT C 6: 47,808,306 probably null Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sbp AAGA AAGACGCTGACAACAGAGA 17: 23,945,384 probably benign Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Slc39a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02558:Slc39a4 APN 15 76614203 missense probably damaging 1.00
IGL02597:Slc39a4 APN 15 76613624 missense probably benign
IGL02798:Slc39a4 APN 15 76615182 missense probably benign 0.04
texline UTSW 15 76614083 missense probably damaging 1.00
R0519:Slc39a4 UTSW 15 76615138 missense probably benign 0.38
R0815:Slc39a4 UTSW 15 76612639 missense probably damaging 1.00
R1502:Slc39a4 UTSW 15 76616593 missense probably benign 0.00
R1547:Slc39a4 UTSW 15 76614147 nonsense probably null
R2919:Slc39a4 UTSW 15 76616670 missense probably damaging 1.00
R4634:Slc39a4 UTSW 15 76614493 missense probably benign
R5029:Slc39a4 UTSW 15 76614083 missense probably damaging 1.00
R5030:Slc39a4 UTSW 15 76614083 missense probably damaging 1.00
R5669:Slc39a4 UTSW 15 76614163 missense probably damaging 1.00
R6020:Slc39a4 UTSW 15 76616142 missense probably benign 0.03
R6741:Slc39a4 UTSW 15 76614083 missense probably damaging 1.00
R6920:Slc39a4 UTSW 15 76613270 missense probably damaging 0.99
R7072:Slc39a4 UTSW 15 76613258 missense probably damaging 1.00
RF035:Slc39a4 UTSW 15 76614866 small insertion probably benign
RF039:Slc39a4 UTSW 15 76614870 small insertion probably benign
RF039:Slc39a4 UTSW 15 76614871 small insertion probably benign
RF040:Slc39a4 UTSW 15 76614866 small insertion probably benign
RF041:Slc39a4 UTSW 15 76614866 small insertion probably benign
RF043:Slc39a4 UTSW 15 76614870 small insertion probably benign
RF044:Slc39a4 UTSW 15 76614870 small insertion probably benign
Z1176:Slc39a4 UTSW 15 76614173 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGAACAGACCCATGGAAGG -3'
(R):5'- GACTTTGTGTTCAGGCTACAC -3'

Sequencing Primer
(F):5'- CAGACCCATGGAAGGTTGTC -3'
(R):5'- CAATATCACGCTGCATGGTG -3'
Posted On2019-12-04