Incidental Mutation 'RF042:Lca5l'
ID604884
Institutional Source Beutler Lab
Gene Symbol Lca5l
Ensembl Gene ENSMUSG00000045275
Gene NameLeber congenital amaurosis 5-like
Synonyms4921526F01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #RF042 (G1)
Quality Score214.458
Status Not validated
Chromosome16
Chromosomal Location96158407-96192257 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCCCTGGCCCTGGCCCC to GCCC at 96159297 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000061337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023913] [ENSMUST00000054855] [ENSMUST00000113804]
Predicted Effect probably benign
Transcript: ENSMUST00000023913
SMART Domains Protein: ENSMUSP00000023913
Gene: ENSMUSG00000023147

DomainStartEndE-ValueType
Pfam:CHD5 12 163 1.4e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000054855
SMART Domains Protein: ENSMUSP00000061337
Gene: ENSMUSG00000045275

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
Pfam:Lebercilin 144 336 5.6e-68 PFAM
low complexity region 528 544 N/A INTRINSIC
low complexity region 654 670 N/A INTRINSIC
low complexity region 679 688 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113804
SMART Domains Protein: ENSMUSP00000109435
Gene: ENSMUSG00000045275

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
Pfam:Lebercilin 138 331 1.9e-71 PFAM
low complexity region 523 539 N/A INTRINSIC
low complexity region 649 665 N/A INTRINSIC
low complexity region 674 683 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,217 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 TCT TCTACT X: 75,000,005 probably benign Het
Gab3 TTC TTCGTC X: 75,000,022 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Iqcf4 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT 9: 106,570,605 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,125 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lce1m CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC 3: 93,018,139 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 A AGCC X: 71,118,853 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Pdia4 CTCTTCCTCCT C 6: 47,808,306 probably null Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sbp AAGA AAGACGCTGACAACAGAGA 17: 23,945,384 probably benign Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Slc39a4 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC 15: 76,614,871 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Lca5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:Lca5l APN 16 96161412 missense possibly damaging 0.90
IGL02893:Lca5l APN 16 96178913 missense probably benign 0.01
IGL03056:Lca5l APN 16 96161351 missense probably benign 0.26
IGL03208:Lca5l APN 16 96178846 missense probably damaging 0.98
IGL03267:Lca5l APN 16 96159783 missense probably benign 0.03
R0417:Lca5l UTSW 16 96162653 missense probably damaging 1.00
R0961:Lca5l UTSW 16 96161360 missense possibly damaging 0.90
R1458:Lca5l UTSW 16 96159859 missense possibly damaging 0.95
R1650:Lca5l UTSW 16 96178940 critical splice acceptor site probably null
R1669:Lca5l UTSW 16 96159808 missense possibly damaging 0.95
R1706:Lca5l UTSW 16 96175964 missense probably benign 0.41
R2004:Lca5l UTSW 16 96162649 missense probably damaging 1.00
R2004:Lca5l UTSW 16 96176018 missense possibly damaging 0.95
R4291:Lca5l UTSW 16 96178774 missense probably damaging 1.00
R4307:Lca5l UTSW 16 96159556 unclassified probably benign
R4824:Lca5l UTSW 16 96162029 nonsense probably null
R4920:Lca5l UTSW 16 96178835 missense probably damaging 1.00
R4991:Lca5l UTSW 16 96159732 missense possibly damaging 0.90
R5591:Lca5l UTSW 16 96178729 missense probably damaging 1.00
R5774:Lca5l UTSW 16 96176061 missense probably benign 0.22
R6243:Lca5l UTSW 16 96178912 missense possibly damaging 0.90
R6403:Lca5l UTSW 16 96173845 missense probably benign 0.41
R7153:Lca5l UTSW 16 96173809 missense probably damaging 0.98
R7754:Lca5l UTSW 16 96159561 missense unknown
R7758:Lca5l UTSW 16 96178837 missense probably benign 0.00
R7814:Lca5l UTSW 16 96162557 critical splice donor site probably null
R8357:Lca5l UTSW 16 96159708 missense possibly damaging 0.95
RF031:Lca5l UTSW 16 96159304 frame shift probably null
RF050:Lca5l UTSW 16 96159301 small deletion probably benign
RF059:Lca5l UTSW 16 96159301 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGCATTTAAACAACAGTCTTCC -3'
(R):5'- AGCACTACTCCTTCACCGAG -3'

Sequencing Primer
(F):5'- CAGTCTTCCTGTTGGCTTCGG -3'
(R):5'- TCCTTCACCGAGGCCAC -3'
Posted On2019-12-04