Incidental Mutation 'RF042:Sbp'
ID604885
Institutional Source Beutler Lab
Gene Symbol Sbp
Ensembl Gene ENSMUSG00000024128
Gene Namespermine binding protein
Synonymsp25
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #RF042 (G1)
Quality Score217.468
Status Not validated
Chromosome17
Chromosomal Location23941672-23945607 bp(+) (GRCm38)
Type of Mutationsmall insertion (5 aa in frame mutation)
DNA Base Change (assembly) AAGA to AAGACGCTGACAACAGAGA at 23945384 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024940] [ENSMUST00000181985] [ENSMUST00000182519] [ENSMUST00000182868] [ENSMUST00000183017] [ENSMUST00000183155] [ENSMUST00000183252]
Predicted Effect probably benign
Transcript: ENSMUST00000024940
SMART Domains Protein: ENSMUSP00000024940
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Jacalin 26 151 2.32e-15 SMART
low complexity region 161 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181985
SMART Domains Protein: ENSMUSP00000138422
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Jacalin 26 151 2.32e-15 SMART
low complexity region 161 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182519
SMART Domains Protein: ENSMUSP00000138338
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:Jacalin 26 87 3e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000182868
SMART Domains Protein: ENSMUSP00000138491
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Jacalin 53 178 2.32e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183017
Predicted Effect probably benign
Transcript: ENSMUST00000183155
SMART Domains Protein: ENSMUSP00000138341
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Jacalin 26 151 2.32e-15 SMART
low complexity region 161 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183252
SMART Domains Protein: ENSMUSP00000138219
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Jacalin 26 151 2.32e-15 SMART
low complexity region 161 198 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,217 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 TCT TCTACT X: 75,000,005 probably benign Het
Gab3 TTC TTCGTC X: 75,000,022 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Iqcf4 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT 9: 106,570,605 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,125 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lca5l GCCCTGGCCCTGGCCCC GCCC 16: 96,159,297 probably null Het
Lce1m CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC 3: 93,018,139 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 A AGCC X: 71,118,853 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Pdia4 CTCTTCCTCCT C 6: 47,808,306 probably null Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Slc39a4 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC 15: 76,614,871 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Sbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Sbp APN 17 23945348 utr 3 prime probably benign
IGL02035:Sbp APN 17 23942612 missense possibly damaging 0.73
FR4449:Sbp UTSW 17 23945364 small insertion probably benign
FR4737:Sbp UTSW 17 23945382 small insertion probably benign
FR4737:Sbp UTSW 17 23945389 small insertion probably benign
R0457:Sbp UTSW 17 23945312 missense probably benign 0.04
R1083:Sbp UTSW 17 23942730 splice site probably benign
R1544:Sbp UTSW 17 23945069 missense probably benign 0.01
R2075:Sbp UTSW 17 23945158 splice site probably null
R3741:Sbp UTSW 17 23945582 utr 3 prime probably benign
R4513:Sbp UTSW 17 23945312 missense probably benign 0.04
R4774:Sbp UTSW 17 23945244 missense probably damaging 1.00
R5338:Sbp UTSW 17 23942422 start gained probably benign
R5576:Sbp UTSW 17 23945578 missense probably benign 0.05
R7315:Sbp UTSW 17 23945306 missense probably benign 0.10
R7894:Sbp UTSW 17 23942189 intron probably benign
RF003:Sbp UTSW 17 23945369 small insertion probably benign
RF010:Sbp UTSW 17 23945351 small insertion probably benign
RF011:Sbp UTSW 17 23945354 small insertion probably benign
RF024:Sbp UTSW 17 23945387 small insertion probably benign
RF037:Sbp UTSW 17 23945384 small insertion probably benign
RF037:Sbp UTSW 17 23945387 small insertion probably benign
RF038:Sbp UTSW 17 23945384 small insertion probably benign
RF044:Sbp UTSW 17 23945366 small insertion probably benign
RF048:Sbp UTSW 17 23945389 small insertion probably benign
RF054:Sbp UTSW 17 23945371 small insertion probably benign
RF056:Sbp UTSW 17 23945366 small insertion probably benign
RF059:Sbp UTSW 17 23945377 small insertion probably benign
RF061:Sbp UTSW 17 23945377 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GGAGGTTCAGACAAGCATCTAG -3'
(R):5'- TCAGGCTCACATAGATGCAC -3'

Sequencing Primer
(F):5'- GTTCAGACAAGCATCTAGTGACTGTC -3'
(R):5'- GGCATTTGGGCTTTGCTCCC -3'
Posted On2019-12-04