Incidental Mutation 'RF042:Tfeb'
ID604887
Institutional Source Beutler Lab
Gene Symbol Tfeb
Ensembl Gene ENSMUSG00000023990
Gene Nametranscription factor EB
SynonymsbHLHe35, TFEB, Tcfeb
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF042 (G1)
Quality Score168.468
Status Not validated
Chromosome17
Chromosomal Location47737030-47792419 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GCA to GCACCA at 47786097 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024786] [ENSMUST00000086932] [ENSMUST00000113284] [ENSMUST00000113288] [ENSMUST00000125177] [ENSMUST00000126258] [ENSMUST00000130208] [ENSMUST00000137845] [ENSMUST00000141631] [ENSMUST00000146782] [ENSMUST00000159641] [ENSMUST00000160373]
Predicted Effect probably benign
Transcript: ENSMUST00000024786
SMART Domains Protein: ENSMUSP00000024786
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
Pfam:MITF_TFEB_C_3_N 63 220 2e-69 PFAM
HLH 299 352 1.44e-15 SMART
Pfam:DUF3371 379 531 1.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086932
SMART Domains Protein: ENSMUSP00000084151
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113284
SMART Domains Protein: ENSMUSP00000108909
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
Pfam:HLH 235 266 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113288
SMART Domains Protein: ENSMUSP00000108913
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125177
SMART Domains Protein: ENSMUSP00000121888
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 42 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126258
Predicted Effect probably benign
Transcript: ENSMUST00000130208
SMART Domains Protein: ENSMUSP00000122228
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137845
Predicted Effect probably benign
Transcript: ENSMUST00000141631
SMART Domains Protein: ENSMUSP00000118057
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146782
SMART Domains Protein: ENSMUSP00000120311
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
HLH 99 152 1.44e-15 SMART
Pfam:DUF3371 179 332 1.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159641
SMART Domains Protein: ENSMUSP00000124379
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160373
SMART Domains Protein: ENSMUSP00000124708
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,217 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 TCT TCTACT X: 75,000,005 probably benign Het
Gab3 TTC TTCGTC X: 75,000,022 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Iqcf4 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT 9: 106,570,605 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,125 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lca5l GCCCTGGCCCTGGCCCC GCCC 16: 96,159,297 probably null Het
Lce1m CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC 3: 93,018,139 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 A AGCC X: 71,118,853 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Pdia4 CTCTTCCTCCT C 6: 47,808,306 probably null Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sbp AAGA AAGACGCTGACAACAGAGA 17: 23,945,384 probably benign Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Slc39a4 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC 15: 76,614,871 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Tfeb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Tfeb APN 17 47791664 missense probably benign 0.10
IGL03248:Tfeb APN 17 47786995 missense probably benign
IGL03280:Tfeb APN 17 47785937 missense probably benign
FR4304:Tfeb UTSW 17 47786094 small insertion probably benign
FR4976:Tfeb UTSW 17 47786094 small insertion probably benign
R0414:Tfeb UTSW 17 47788299 splice site probably null
R1712:Tfeb UTSW 17 47788986 critical splice donor site probably null
R2014:Tfeb UTSW 17 47791559 missense probably damaging 0.97
R2101:Tfeb UTSW 17 47789665 missense probably damaging 1.00
R4283:Tfeb UTSW 17 47789774 missense probably damaging 1.00
R4734:Tfeb UTSW 17 47785862 missense probably benign 0.33
R4785:Tfeb UTSW 17 47788227 splice site probably null
R4948:Tfeb UTSW 17 47785979 missense probably benign 0.00
R5896:Tfeb UTSW 17 47759508 critical splice donor site probably null
R6522:Tfeb UTSW 17 47789702 missense probably damaging 1.00
R6804:Tfeb UTSW 17 47789810 critical splice donor site probably null
R6836:Tfeb UTSW 17 47786198 critical splice donor site probably null
R6923:Tfeb UTSW 17 47786983 missense probably benign 0.11
RF002:Tfeb UTSW 17 47786102 small insertion probably benign
RF003:Tfeb UTSW 17 47788078 missense possibly damaging 0.86
RF006:Tfeb UTSW 17 47786113 small insertion probably benign
RF008:Tfeb UTSW 17 47786102 small insertion probably benign
RF010:Tfeb UTSW 17 47786094 small insertion probably benign
RF010:Tfeb UTSW 17 47786107 small insertion probably benign
RF018:Tfeb UTSW 17 47786095 small insertion probably benign
RF022:Tfeb UTSW 17 47786094 small insertion probably benign
RF025:Tfeb UTSW 17 47786088 small insertion probably benign
RF028:Tfeb UTSW 17 47786097 small insertion probably benign
RF030:Tfeb UTSW 17 47786111 small insertion probably benign
RF030:Tfeb UTSW 17 47786112 small insertion probably benign
RF030:Tfeb UTSW 17 47786113 small insertion probably benign
RF034:Tfeb UTSW 17 47786097 small insertion probably benign
RF034:Tfeb UTSW 17 47786098 nonsense probably null
RF035:Tfeb UTSW 17 47786111 small insertion probably benign
RF036:Tfeb UTSW 17 47786103 small insertion probably benign
RF038:Tfeb UTSW 17 47786105 small insertion probably benign
RF038:Tfeb UTSW 17 47786112 small insertion probably benign
RF039:Tfeb UTSW 17 47786095 small insertion probably benign
RF039:Tfeb UTSW 17 47786110 nonsense probably null
RF040:Tfeb UTSW 17 47786097 small insertion probably benign
RF040:Tfeb UTSW 17 47786110 small insertion probably benign
RF040:Tfeb UTSW 17 47786111 small insertion probably benign
RF040:Tfeb UTSW 17 47786112 small insertion probably benign
RF041:Tfeb UTSW 17 47786100 small insertion probably benign
RF047:Tfeb UTSW 17 47786106 small insertion probably benign
RF047:Tfeb UTSW 17 47786116 small insertion probably benign
RF053:Tfeb UTSW 17 47786114 small insertion probably benign
RF054:Tfeb UTSW 17 47786098 nonsense probably null
RF060:Tfeb UTSW 17 47786106 small insertion probably benign
RF061:Tfeb UTSW 17 47786092 small insertion probably benign
RF062:Tfeb UTSW 17 47786100 small insertion probably benign
Z1177:Tfeb UTSW 17 47786524 nonsense probably null
Z1177:Tfeb UTSW 17 47791644 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TGAATACTTCATGGGCCTGTC -3'
(R):5'- CAGATACTCCCGAACCTTCTG -3'

Sequencing Primer
(F):5'- TCTCCCCTCGACTACAGGGAG -3'
(R):5'- AACCTTCTGATGCTGGGAC -3'
Posted On2019-12-04