Incidental Mutation 'RF042:Gykl1'
ID604888
Institutional Source Beutler Lab
Gene Symbol Gykl1
Ensembl Gene ENSMUSG00000053624
Gene Nameglycerol kinase-like 1
SynonymsGk-rs1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #RF042 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location52693679-52695668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52694416 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 232 (R232Q)
Ref Sequence ENSEMBL: ENSMUSP00000067598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066193]
Predicted Effect probably benign
Transcript: ENSMUST00000066193
AA Change: R232Q

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000067598
Gene: ENSMUSG00000053624
AA Change: R232Q

DomainStartEndE-ValueType
Pfam:FGGY_N 12 266 6.8e-90 PFAM
Pfam:FGGY_C 275 467 4.2e-66 PFAM
transmembrane domain 524 546 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the FGGY kinase family. This protein is a key enzyme in the regulation of glycerol uptake and metabolism. It catalyzes the phosphorylation of glycerol by ATP, yielding ADP and glycerol-3-phosphate. Mutations in this gene are associated with glycerol kinase deficiency (GKD). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,217 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 TCT TCTACT X: 75,000,005 probably benign Het
Gab3 TTC TTCGTC X: 75,000,022 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Iqcf4 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT 9: 106,570,605 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,125 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lca5l GCCCTGGCCCTGGCCCC GCCC 16: 96,159,297 probably null Het
Lce1m CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC 3: 93,018,139 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 A AGCC X: 71,118,853 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Pdia4 CTCTTCCTCCT C 6: 47,808,306 probably null Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sbp AAGA AAGACGCTGACAACAGAGA 17: 23,945,384 probably benign Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Slc39a4 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC 15: 76,614,871 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Gykl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Gykl1 APN 18 52694736 missense possibly damaging 0.94
IGL02694:Gykl1 APN 18 52694185 missense probably benign 0.00
R0689:Gykl1 UTSW 18 52694051 missense possibly damaging 0.90
R0856:Gykl1 UTSW 18 52695369 makesense probably null
R0908:Gykl1 UTSW 18 52695369 makesense probably null
R1428:Gykl1 UTSW 18 52694761 missense probably benign 0.00
R2229:Gykl1 UTSW 18 52695267 missense probably benign 0.00
R5307:Gykl1 UTSW 18 52694651 missense possibly damaging 0.67
R5696:Gykl1 UTSW 18 52694195 missense probably benign 0.02
R6278:Gykl1 UTSW 18 52695208 missense probably benign 0.06
RF040:Gykl1 UTSW 18 52694416 missense probably benign 0.06
RF041:Gykl1 UTSW 18 52694416 missense probably benign 0.06
RF044:Gykl1 UTSW 18 52694416 missense probably benign 0.06
Z1088:Gykl1 UTSW 18 52694165 nonsense probably null
Z1176:Gykl1 UTSW 18 52694547 missense probably damaging 1.00
Z1177:Gykl1 UTSW 18 52695132 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGACAGGCCTTCCAATCAGC -3'
(R):5'- ACACACTTCTGGCCTGTGTTAC -3'

Sequencing Primer
(F):5'- CACTGGCTCATTGAAAATGTGAG -3'
(R):5'- CTGGCCTGTGTTACATAGTAAGAAAC -3'
Posted On2019-12-04