Incidental Mutation 'RF042:AI837181'
ID604889
Institutional Source Beutler Lab
Gene Symbol AI837181
Ensembl Gene ENSMUSG00000047423
Gene Nameexpressed sequence AI837181
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF042 (G1)
Quality Score126.467
Status Not validated
Chromosome19
Chromosomal Location5425157-5427313 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GGC to GGCTGC at 5425217 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025853] [ENSMUST00000113673] [ENSMUST00000113674] [ENSMUST00000136579] [ENSMUST00000148219] [ENSMUST00000159759]
Predicted Effect probably benign
Transcript: ENSMUST00000025853
SMART Domains Protein: ENSMUSP00000025853
Gene: ENSMUSG00000024914

DomainStartEndE-ValueType
Pfam:Histone 4 76 2.1e-8 PFAM
Pfam:CBFD_NFYB_HMF 10 74 1e-20 PFAM
low complexity region 103 123 N/A INTRINSIC
low complexity region 134 155 N/A INTRINSIC
low complexity region 172 194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113673
SMART Domains Protein: ENSMUSP00000109303
Gene: ENSMUSG00000024914

DomainStartEndE-ValueType
Pfam:CBFD_NFYB_HMF 1 54 6.7e-14 PFAM
Pfam:Histone 1 56 1.8e-6 PFAM
low complexity region 83 103 N/A INTRINSIC
low complexity region 114 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113674
SMART Domains Protein: ENSMUSP00000109304
Gene: ENSMUSG00000024914

DomainStartEndE-ValueType
Pfam:CBFD_NFYB_HMF 10 74 5e-22 PFAM
low complexity region 114 130 N/A INTRINSIC
low complexity region 141 162 N/A INTRINSIC
low complexity region 179 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136579
SMART Domains Protein: ENSMUSP00000133692
Gene: ENSMUSG00000024914

DomainStartEndE-ValueType
Pfam:CBFD_NFYB_HMF 1 54 8.7e-14 PFAM
Pfam:Histone 1 56 2.3e-6 PFAM
low complexity region 83 103 N/A INTRINSIC
low complexity region 114 135 N/A INTRINSIC
low complexity region 152 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148219
SMART Domains Protein: ENSMUSP00000121162
Gene: ENSMUSG00000024914

DomainStartEndE-ValueType
Pfam:Histone 4 76 9.4e-10 PFAM
Pfam:CBFD_NFYB_HMF 10 74 4.5e-22 PFAM
low complexity region 103 123 N/A INTRINSIC
low complexity region 134 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159759
SMART Domains Protein: ENSMUSP00000125651
Gene: ENSMUSG00000047423

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
low complexity region 69 82 N/A INTRINSIC
Pfam:DUF1917 139 259 6.1e-19 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 TCT TCTACT X: 75,000,005 probably benign Het
Gab3 TTC TTCGTC X: 75,000,022 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Iqcf4 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT 9: 106,570,605 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,125 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lca5l GCCCTGGCCCTGGCCCC GCCC 16: 96,159,297 probably null Het
Lce1m CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC 3: 93,018,139 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 A AGCC X: 71,118,853 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Pdia4 CTCTTCCTCCT C 6: 47,808,306 probably null Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sbp AAGA AAGACGCTGACAACAGAGA 17: 23,945,384 probably benign Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Slc39a4 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC 15: 76,614,871 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in AI837181
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4548:AI837181 UTSW 19 5425231 small insertion probably benign
FR4548:AI837181 UTSW 19 5425237 small insertion probably benign
FR4976:AI837181 UTSW 19 5425229 small insertion probably benign
R0357:AI837181 UTSW 19 5426703 missense possibly damaging 0.49
R1944:AI837181 UTSW 19 5426229 missense probably damaging 0.96
R4846:AI837181 UTSW 19 5426301 missense probably benign 0.23
R7269:AI837181 UTSW 19 5426434 missense probably damaging 1.00
R7561:AI837181 UTSW 19 5426463 missense probably damaging 1.00
R7761:AI837181 UTSW 19 5426291 missense probably benign 0.03
RF002:AI837181 UTSW 19 5425234 small insertion probably benign
RF002:AI837181 UTSW 19 5425235 small insertion probably benign
RF008:AI837181 UTSW 19 5425238 small insertion probably benign
RF009:AI837181 UTSW 19 5425234 small insertion probably benign
RF011:AI837181 UTSW 19 5425236 small insertion probably benign
RF012:AI837181 UTSW 19 5425227 small insertion probably benign
RF013:AI837181 UTSW 19 5425232 small insertion probably benign
RF021:AI837181 UTSW 19 5425234 small insertion probably benign
RF025:AI837181 UTSW 19 5425226 small insertion probably benign
RF026:AI837181 UTSW 19 5425224 small insertion probably benign
RF030:AI837181 UTSW 19 5425226 small insertion probably benign
RF030:AI837181 UTSW 19 5425235 small insertion probably benign
RF031:AI837181 UTSW 19 5425218 small insertion probably benign
RF033:AI837181 UTSW 19 5425224 small insertion probably benign
RF033:AI837181 UTSW 19 5425237 small insertion probably benign
RF035:AI837181 UTSW 19 5425238 small insertion probably benign
RF038:AI837181 UTSW 19 5425226 small insertion probably benign
RF038:AI837181 UTSW 19 5425236 small insertion probably benign
RF041:AI837181 UTSW 19 5425229 small insertion probably benign
RF042:AI837181 UTSW 19 5425237 small insertion probably benign
RF045:AI837181 UTSW 19 5425218 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AAAGTACGAACGTTAGCTCCG -3'
(R):5'- TCGAACCAGATAGGACCAGG -3'

Sequencing Primer
(F):5'- GAACGTTAGCTCCGCCTCC -3'
(R):5'- AGATAGGACCAGGCCTGC -3'
Posted On2019-12-04