Incidental Mutation 'RF042:Mamld1'
ID604895
Institutional Source Beutler Lab
Gene Symbol Mamld1
Ensembl Gene ENSMUSG00000059401
Gene Namemastermind-like domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF042 (G1)
Quality Score178.468
Status Not validated
ChromosomeX
Chromosomal Location71050256-71156056 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) A to AGCC at 71118853 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082088] [ENSMUST00000114629]
Predicted Effect probably benign
Transcript: ENSMUST00000082088
SMART Domains Protein: ENSMUSP00000080737
Gene: ENSMUSG00000059401

DomainStartEndE-ValueType
low complexity region 153 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
internal_repeat_1 363 414 3.74e-7 PROSPERO
internal_repeat_1 418 466 3.74e-7 PROSPERO
low complexity region 571 588 N/A INTRINSIC
low complexity region 592 637 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114629
SMART Domains Protein: ENSMUSP00000110276
Gene: ENSMUSG00000059401

DomainStartEndE-ValueType
low complexity region 153 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
internal_repeat_1 363 414 2.31e-7 PROSPERO
internal_repeat_1 418 466 2.31e-7 PROSPERO
low complexity region 571 588 N/A INTRINSIC
low complexity region 592 637 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice exhibit normal male genitalia and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,217 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 TCT TCTACT X: 75,000,005 probably benign Het
Gab3 TTC TTCGTC X: 75,000,022 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Iqcf4 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT 9: 106,570,605 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,125 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lca5l GCCCTGGCCCTGGCCCC GCCC 16: 96,159,297 probably null Het
Lce1m CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC 3: 93,018,139 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Pdia4 CTCTTCCTCCT C 6: 47,808,306 probably null Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sbp AAGA AAGACGCTGACAACAGAGA 17: 23,945,384 probably benign Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Slc39a4 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC 15: 76,614,871 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Mamld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02484:Mamld1 APN X 71118652 missense possibly damaging 0.93
FR4340:Mamld1 UTSW X 71118846 small insertion probably benign
FR4737:Mamld1 UTSW X 71118835 small insertion probably benign
FR4737:Mamld1 UTSW X 71118839 small insertion probably benign
FR4976:Mamld1 UTSW X 71118812 small insertion probably benign
FR4976:Mamld1 UTSW X 71118818 small insertion probably benign
R2133:Mamld1 UTSW X 71119392 missense probably benign 0.00
R2277:Mamld1 UTSW X 71118815 small deletion probably benign
RF003:Mamld1 UTSW X 71118820 small insertion probably benign
RF004:Mamld1 UTSW X 71118831 nonsense probably null
RF014:Mamld1 UTSW X 71118845 small insertion probably benign
RF015:Mamld1 UTSW X 71118820 small insertion probably benign
RF015:Mamld1 UTSW X 71118841 small insertion probably benign
RF018:Mamld1 UTSW X 71118849 small insertion probably benign
RF022:Mamld1 UTSW X 71118820 small insertion probably benign
RF025:Mamld1 UTSW X 71118826 small insertion probably benign
RF030:Mamld1 UTSW X 71118828 nonsense probably null
RF033:Mamld1 UTSW X 71118833 small insertion probably benign
RF034:Mamld1 UTSW X 71118835 small insertion probably benign
RF035:Mamld1 UTSW X 71118812 small insertion probably benign
RF035:Mamld1 UTSW X 71118838 small insertion probably benign
RF035:Mamld1 UTSW X 71118850 small insertion probably benign
RF036:Mamld1 UTSW X 71118828 small insertion probably benign
RF036:Mamld1 UTSW X 71118835 small insertion probably benign
RF036:Mamld1 UTSW X 71118840 small insertion probably benign
RF038:Mamld1 UTSW X 71118846 small insertion probably benign
RF039:Mamld1 UTSW X 71118826 small insertion probably benign
RF039:Mamld1 UTSW X 71118840 small insertion probably benign
RF040:Mamld1 UTSW X 71118814 small insertion probably benign
RF041:Mamld1 UTSW X 71118826 small insertion probably benign
RF041:Mamld1 UTSW X 71118829 small insertion probably benign
RF042:Mamld1 UTSW X 71118812 small insertion probably benign
RF043:Mamld1 UTSW X 71118835 small insertion probably benign
RF047:Mamld1 UTSW X 71118839 small insertion probably benign
RF048:Mamld1 UTSW X 71118852 nonsense probably null
RF049:Mamld1 UTSW X 71118833 small insertion probably benign
RF049:Mamld1 UTSW X 71118845 small insertion probably benign
RF053:Mamld1 UTSW X 71118852 small insertion probably benign
RF055:Mamld1 UTSW X 71118837 small insertion probably benign
RF059:Mamld1 UTSW X 71118832 small insertion probably benign
RF060:Mamld1 UTSW X 71118831 nonsense probably null
RF060:Mamld1 UTSW X 71118832 small insertion probably benign
RF061:Mamld1 UTSW X 71118850 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GATATCTGCTCTGCCTACCAGC -3'
(R):5'- AGACATGGAGGCCATCTTCTG -3'

Sequencing Primer
(F):5'- TACCAGCACCCCAGGGC -3'
(R):5'- TGGGGGCTTGGCTCAGAAAC -3'
Posted On2019-12-04