Incidental Mutation 'RF042:Gab3'
ID604898
Institutional Source Beutler Lab
Gene Symbol Gab3
Ensembl Gene ENSMUSG00000032750
Gene Namegrowth factor receptor bound protein 2-associated protein 3
Synonyms5930433H21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF042 (G1)
Quality Score159.468
Status Not validated
ChromosomeX
Chromosomal Location74966843-75085458 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) TTC to TTCGTC at 75000022 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037374] [ENSMUST00000114104] [ENSMUST00000114109]
Predicted Effect probably benign
Transcript: ENSMUST00000037374
SMART Domains Protein: ENSMUSP00000041951
Gene: ENSMUSG00000032750

DomainStartEndE-ValueType
PH 6 119 3.2e-21 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 307 314 N/A INTRINSIC
low complexity region 424 435 N/A INTRINSIC
coiled coil region 494 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114104
SMART Domains Protein: ENSMUSP00000109739
Gene: ENSMUSG00000032750

DomainStartEndE-ValueType
PH 6 119 3.2e-21 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 307 314 N/A INTRINSIC
low complexity region 424 435 N/A INTRINSIC
coiled coil region 495 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114109
SMART Domains Protein: ENSMUSP00000109744
Gene: ENSMUSG00000032750

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
coiled coil region 97 123 N/A INTRINSIC
Pfam:Pcc1 170 228 1.1e-9 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the GRB2-associated binding protein gene family. These proteins are scaffolding/docking proteins that are involved in several growth factor and cytokine signaling pathways, and they contain a pleckstrin homology domain, and bind SHP2 tyrosine phosphatase and GRB2 adapter protein. The protein encoded by this gene facilitates macrophage differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Females homozygous and males hemizygous for disruptions in this X-linked gene developed normally, exhibted normal hematopoiesis, and were immunocompetent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,217 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Iqcf4 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT 9: 106,570,605 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,125 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lca5l GCCCTGGCCCTGGCCCC GCCC 16: 96,159,297 probably null Het
Lce1m CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC 3: 93,018,139 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 A AGCC X: 71,118,853 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Pdia4 CTCTTCCTCCT C 6: 47,808,306 probably null Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sbp AAGA AAGACGCTGACAACAGAGA 17: 23,945,384 probably benign Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Slc39a4 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC 15: 76,614,871 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Gab3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Gab3 APN X 75005359 missense probably benign 0.00
R0894:Gab3 UTSW X 75033418 missense probably damaging 1.00
R2069:Gab3 UTSW X 75000095 missense probably damaging 1.00
R2102:Gab3 UTSW X 74999979 small insertion probably benign
RF001:Gab3 UTSW X 75000018 small insertion probably benign
RF003:Gab3 UTSW X 75000006 nonsense probably null
RF006:Gab3 UTSW X 75000027 small insertion probably benign
RF007:Gab3 UTSW X 74999996 small insertion probably benign
RF007:Gab3 UTSW X 75000011 small insertion probably benign
RF007:Gab3 UTSW X 75000025 small insertion probably benign
RF009:Gab3 UTSW X 74999992 small insertion probably benign
RF009:Gab3 UTSW X 75000024 nonsense probably null
RF010:Gab3 UTSW X 75000011 small insertion probably benign
RF012:Gab3 UTSW X 75000020 small insertion probably benign
RF016:Gab3 UTSW X 74999985 nonsense probably null
RF020:Gab3 UTSW X 75000017 small insertion probably benign
RF022:Gab3 UTSW X 74999994 nonsense probably null
RF025:Gab3 UTSW X 75000008 small insertion probably benign
RF026:Gab3 UTSW X 74999990 small insertion probably benign
RF026:Gab3 UTSW X 75000023 small insertion probably benign
RF028:Gab3 UTSW X 75000000 nonsense probably null
RF028:Gab3 UTSW X 75000017 small insertion probably benign
RF030:Gab3 UTSW X 74999977 small deletion probably benign
RF030:Gab3 UTSW X 75000005 small insertion probably benign
RF030:Gab3 UTSW X 75000008 small insertion probably benign
RF030:Gab3 UTSW X 75000025 small insertion probably benign
RF030:Gab3 UTSW X 75000026 small insertion probably benign
RF031:Gab3 UTSW X 74999996 small insertion probably benign
RF031:Gab3 UTSW X 74999997 nonsense probably null
RF031:Gab3 UTSW X 75000001 small insertion probably benign
RF033:Gab3 UTSW X 75000001 small insertion probably benign
RF033:Gab3 UTSW X 75000023 small insertion probably benign
RF039:Gab3 UTSW X 75000004 small insertion probably benign
RF040:Gab3 UTSW X 75000027 small insertion probably benign
RF042:Gab3 UTSW X 75000005 small insertion probably benign
RF044:Gab3 UTSW X 75000005 small insertion probably benign
RF047:Gab3 UTSW X 74999993 small insertion probably benign
RF052:Gab3 UTSW X 74999983 small insertion probably benign
RF055:Gab3 UTSW X 74999987 small insertion probably benign
RF055:Gab3 UTSW X 75000010 small insertion probably benign
RF058:Gab3 UTSW X 75000002 small insertion probably benign
RF059:Gab3 UTSW X 74999990 small insertion probably benign
RF060:Gab3 UTSW X 75000013 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCGGTGACCTGGTTTTATAATAAGC -3'
(R):5'- TTTGGAAGGAACAGGCTCAAACC -3'

Sequencing Primer
(F):5'- AAGCCATTCTTTATGACTGCACAC -3'
(R):5'- CCCACAGGGCTGTCTGTTC -3'
Posted On2019-12-04