Mutagenetix > Incidental Mutation

Incidental Mutation 'R0128:Cr2'

60490

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

038413-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R0128 (G1)

Quality Score

214

Status

Validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 195166231 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 328 (V328D)

Ref Sequence

ENSEMBL: ENSMUSP00000147804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043104] [ENSMUST00000082321] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043104
AA Change: V308D

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000044261
Gene: ENSMUSG00000026616
AA Change: V308D

Domain	Start	End	E-Value	Type
CCP	2	58	5.04e-7	SMART
CCP	63	120	3.58e-12	SMART
CCP	125	191	1.2e-13	SMART
CCP	197	252	2.73e-17	SMART
CCP	256	311	1.01e-15	SMART
Blast:CCP	316	347	2e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000082321

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194149

Predicted Effect

probably benign
Transcript: ENSMUST00000195120

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195347

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195722

Predicted Effect

probably damaging
Transcript: ENSMUST00000210219
AA Change: V328D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.0%
3x: 97.6%
10x: 93.0%
20x: 79.3%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	G	6: 128,575,639		probably benign	Het
Abcd4	T	G	12: 84,612,352	Q210P	possibly damaging	Het
Ablim2	G	A	5: 35,809,176		probably benign	Het
Actl6b	A	G	5: 137,555,065	N113S	probably benign	Het
Actn3	A	T	19: 4,871,615	V179E	probably damaging	Het
Aff4	C	A	11: 53,415,466	T1145N	probably damaging	Het
Ankrd42	G	A	7: 92,591,859	Q431*	probably null	Het
Anxa9	A	G	3: 95,302,422	S129P	probably benign	Het
Arfgef2	T	G	2: 166,835,719	I88S	probably damaging	Het
Asap3	C	A	4: 136,234,604	N285K	probably damaging	Het
Atp6v0a2	A	G	5: 124,713,184	N477S	probably damaging	Het
Atp7b	C	T	8: 22,028,172	E205K	possibly damaging	Het
Atp8b5	T	A	4: 43,369,715		probably null	Het
C87436	G	A	6: 86,469,827	G533D	probably damaging	Het
Ccdc138	T	A	10: 58,528,360	I314N	probably damaging	Het
Ccs	A	G	19: 4,825,626	F237S	probably damaging	Het
Ccz1	T	G	5: 144,009,294		probably benign	Het
Cdcp2	C	T	4: 107,106,707		probably benign	Het
Chd1	A	G	17: 17,393,567	N531S	probably damaging	Het
Clptm1	A	T	7: 19,635,007	F476I	probably damaging	Het
Colec12	C	T	18: 9,858,921	P568L	unknown	Het
Cped1	T	A	6: 22,121,039	Y373N	probably benign	Het
D630045J12Rik	A	T	6: 38,149,771		probably benign	Het
Dcdc2a	A	T	13: 25,187,672		probably benign	Het
Dlg1	G	T	16: 31,858,065		probably null	Het
Epb41l5	A	C	1: 119,549,902	V705G	possibly damaging	Het
Ergic3	C	A	2: 156,011,140	R43S	possibly damaging	Het
Flnb	T	C	14: 7,901,951	V938A	probably damaging	Het
Frmd4a	T	C	2: 4,604,092	Y928H	probably damaging	Het
Fyn	C	T	10: 39,511,982	T78M	probably benign	Het
Gdap2	A	G	3: 100,201,995	T443A	probably damaging	Het
Ghrl	A	T	6: 113,717,168		probably benign	Het
Gm1141	T	C	X: 71,939,555	C378R	possibly damaging	Het
Gm12166	A	G	11: 46,052,293	M1T	probably null	Het
Gm4787	T	A	12: 81,377,747	K546*	probably null	Het
Gm498	G	T	7: 143,891,755	G178C	probably damaging	Het
Gm6576	C	G	15: 27,026,000		noncoding transcript	Het
Got1	C	T	19: 43,524,377	D27N	probably benign	Het
Gucy2c	C	T	6: 136,704,249	V946I	probably damaging	Het
Hectd4	T	C	5: 121,349,243	Y3434H	possibly damaging	Het
Hp1bp3	C	T	4: 138,237,209	S348F	probably damaging	Het
Itpr1	A	G	6: 108,471,209		probably benign	Het
Kctd1	G	A	18: 14,974,180	P743S	probably benign	Het
Klhl23	T	C	2: 69,833,966	V553A	probably damaging	Het
Krt24	T	C	11: 99,280,267	D495G	probably damaging	Het
L3hypdh	C	T	12: 72,077,143		probably null	Het
Lipo3	C	T	19: 33,557,106		probably null	Het
Lman2l	G	T	1: 36,424,864	S171*	probably null	Het
Lrp1b	T	C	2: 41,511,508	D378G	probably damaging	Het
Map3k4	T	A	17: 12,248,063	D1104V	probably damaging	Het
Mpeg1	T	C	19: 12,461,223	V15A	probably benign	Het
Narf	C	T	11: 121,250,836	R356C	probably damaging	Het
Nebl	T	A	2: 17,393,023	Q487H	possibly damaging	Het
Olfm5	G	A	7: 104,160,926	A76V	probably benign	Het
Olfr1090	T	C	2: 86,753,887	M284V	probably benign	Het
Olfr339	T	A	2: 36,422,287	D296E	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr656	A	T	7: 104,618,581	I301F	probably damaging	Het
Olfr992	T	A	2: 85,399,961	S191C	probably damaging	Het
Palb2	A	T	7: 122,128,166	Y160*	probably null	Het
Paxip1	C	T	5: 27,744,185		probably benign	Het
Pclo	A	G	5: 14,679,797		probably benign	Het
Pdcd11	G	A	19: 47,119,862	V1223I	probably benign	Het
Pde6c	T	C	19: 38,169,365		probably benign	Het
Prr12	A	G	7: 45,050,039		probably benign	Het
Prss39	T	A	1: 34,502,200		probably benign	Het
Samd5	A	G	10: 9,674,939	W9R	probably damaging	Het
Sfr1	A	G	19: 47,735,018	*320W	probably null	Het
Sh3bp4	A	G	1: 89,145,314	N628S	possibly damaging	Het
Sim1	A	T	10: 50,907,961	I104F	probably damaging	Het
Slc1a3	T	C	15: 8,636,209	M519V	probably benign	Het
Smcp	T	A	3: 92,584,520	T7S	unknown	Het
Sp4	A	G	12: 118,300,816		probably benign	Het
Spag9	T	A	11: 94,093,539	I327N	probably damaging	Het
Thbs4	G	T	13: 92,754,410	H850N	probably benign	Het
Ubap2l	A	T	3: 90,021,373	S478T	possibly damaging	Het
Unc79	A	G	12: 103,088,434		probably benign	Het
Vmn2r85	A	G	10: 130,419,185		probably benign	Het
Wrap73	A	G	4: 154,142,500	D19G	possibly damaging	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9476:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9752:Cr2	UTSW	1	195141267	missense	probably benign	0.37
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- AACCTCTGCCCCAAGCTGGAGATTAG -3'
(R):5'- AACACATGGCCTTCCAAAGTGTGAC -3'

Sequencing Primer
(F):5'- actgctccctctccacc -3'
(R):5'- GCCTTCCAAAGTGTGACACATTG -3'

Posted On

2013-07-24