Incidental Mutation 'RF043:Defb22'
ID604903
Institutional Source Beutler Lab
Gene Symbol Defb22
Ensembl Gene ENSMUSG00000027468
Gene Namedefensin beta 22
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF043 (G1)
Quality Score214.458
Status Not validated
Chromosome2
Chromosomal Location152485663-152490138 bp(-) (GRCm38)
Type of Mutationsmall insertion (6 aa in frame mutation)
DNA Base Change (assembly) GCGGCA to GCGGCAGAGCTGGCCTTTGCGGCA at 152485833 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028966]
Predicted Effect probably benign
Transcript: ENSMUST00000028966
SMART Domains Protein: ENSMUSP00000028966
Gene: ENSMUSG00000027468

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Defensin_beta_2 26 59 4e-11 PFAM
low complexity region 89 150 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Ankhd1 CGGCGG CGGCGGTGGCGG 18: 36,560,917 probably benign Het
Btnl10 CAAA CAAAAAA 11: 58,923,926 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Cyb5r4 ACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,411 probably benign Het
Cyb5r4 AGACACACTGCCCAGGGA AGACACACTGCCCAGGGATGTGACCGACACACTGCCCAGGGA 9: 87,040,431 probably benign Het
Dbr1 GAGGAG GAGGAGCAGGAG 9: 99,583,697 probably benign Het
Emid1 G T 11: 5,144,322 P63Q probably damaging Het
Gabre GCTCCG GCTCCGACTCCG X: 72,270,048 probably benign Het
Gar1 AACTGCC A 3: 129,830,688 probably benign Het
Gm10181 GAGAGAGAGAGAGA G 9: 25,089,459 probably null Het
Hic1 GGGA G 11: 75,169,455 probably benign Het
Il2 GG GGGCTTGAAGTGTG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCGTTTTCCTTTT 9: 106,570,613 probably benign Het
Krtap4-2 AGGGGCGGCAGC A 11: 99,634,721 probably null Het
Lmx1b CATCTTGATGCCGTCCAA CA 2: 33,640,509 probably null Het
Lrch1 TGGTGGTG T 14: 74,947,575 probably null Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAAGA 11: 58,390,243 probably benign Het
Mamld1 AGC AGCTGC X: 71,118,835 probably benign Het
Mrgprx1 GAAC GAACAAC 7: 48,021,509 probably benign Het
Nefh CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA CTTGGCCTCACCTGGGGAATTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA 11: 4,941,016 probably benign Het
Nusap1 AGTGAGGAGCAAGCTGAGA AGTGAGGAGCAAGCTGAGATACACGTTAGCCGTGAGGAGCAAGCTGAGA 2: 119,627,592 probably benign Het
P4ha2 GGTGTTG GG 11: 54,110,250 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Het
Ptms TCCTCCTC TCCTCCTCCTC 6: 124,914,448 probably benign Het
Rassf6 AATGGGGATTC AATGGGGATTCTGCCTCACTCATGGTCCTGTAGAGCCATGGGGATTC 5: 90,608,932 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCAGGGTCCTGTAGAGCAATGGGGCTTC 5: 90,608,939 probably benign Het
Rgs22 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAA 15: 36,010,836 probably benign Het
Rnf144a TCTC TCTCTCTCTCTCTCGCTC 12: 26,314,014 probably benign Het
Rpgrip1 GAG GAGAAG 14: 52,149,395 probably benign Het
Sgpp1 ACACAC A 12: 75,722,625 probably null Het
Slc39a4 GTC GTCATCATGATCACCATGGTCACCATGATCGCTGTGTTC 15: 76,614,870 probably benign Het
Spaca1 TCTCGC TCTCGCGCTCGC 4: 34,049,846 probably benign Het
Stard8 GGA GGATGA X: 99,066,520 probably benign Het
Stard8 GA GAGCA X: 99,066,527 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGAAGGGCACTTTCCCAGGGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGCGGGCTTG 6: 72,616,036 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCGCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Tmed6 AGC AGCTCGC 8: 107,061,596 probably null Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,305 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Defb22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01557:Defb22 APN 2 152486079 missense possibly damaging 0.93
IGL02040:Defb22 APN 2 152490056 missense possibly damaging 0.83
IGL03159:Defb22 APN 2 152490075 missense probably benign 0.00
R5153:Defb22 UTSW 2 152485802 missense unknown
R5387:Defb22 UTSW 2 152485906 missense unknown
R6141:Defb22 UTSW 2 152485802 missense unknown
R7153:Defb22 UTSW 2 152485920 missense unknown
R7385:Defb22 UTSW 2 152486197 missense probably damaging 0.99
R7650:Defb22 UTSW 2 152486103 missense probably benign 0.40
R7671:Defb22 UTSW 2 152486030 missense unknown
RF013:Defb22 UTSW 2 152485831 small insertion probably benign
RF021:Defb22 UTSW 2 152485832 small insertion probably benign
RF025:Defb22 UTSW 2 152485823 small insertion probably benign
RF025:Defb22 UTSW 2 152485824 small insertion probably benign
RF029:Defb22 UTSW 2 152485833 small insertion probably benign
RF034:Defb22 UTSW 2 152485832 small insertion probably benign
RF041:Defb22 UTSW 2 152485823 small insertion probably benign
RF062:Defb22 UTSW 2 152485825 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ACACTGACTTAGGCCTCTTGG -3'
(R):5'- TCAAAATTAGTGGTCACTGTGGG -3'

Sequencing Primer
(F):5'- CTTGGCTTTAATCAACCAGGG -3'
(R):5'- TCAGATAATCTTGTCACAGCAGG -3'
Posted On2019-12-04