Incidental Mutation 'R0128:Frmd4a'
ID60491
Institutional Source Beutler Lab
Gene Symbol Frmd4a
Ensembl Gene ENSMUSG00000026657
Gene NameFERM domain containing 4A
SynonymsGm13190, 2700017I06Rik, C230040M21Rik
MMRRC Submission 038413-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R0128 (G1)
Quality Score148
Status Validated
Chromosome2
Chromosomal Location4017717-4614043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4604092 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 928 (Y928H)
Ref Sequence ENSEMBL: ENSMUSP00000134788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075767] [ENSMUST00000091497] [ENSMUST00000176828] [ENSMUST00000177457]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075767
AA Change: Y913H

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075172
Gene: ENSMUSG00000026657
AA Change: Y913H

DomainStartEndE-ValueType
B41 1 206 3.24e-40 SMART
FERM_C 210 311 7.69e-27 SMART
Pfam:DUF3338 340 477 1.9e-63 PFAM
low complexity region 558 571 N/A INTRINSIC
low complexity region 610 623 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
low complexity region 764 785 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091497
AA Change: Y924H

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000089079
Gene: ENSMUSG00000026657
AA Change: Y924H

DomainStartEndE-ValueType
B41 12 217 3.24e-40 SMART
FERM_C 221 322 7.69e-27 SMART
Pfam:DUF3338 352 487 6.3e-61 PFAM
low complexity region 569 582 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 743 752 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 801 812 N/A INTRINSIC
low complexity region 935 958 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176828
AA Change: Y619H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134803
Gene: ENSMUSG00000026657
AA Change: Y619H

DomainStartEndE-ValueType
Pfam:DUF3338 46 183 4.1e-64 PFAM
low complexity region 264 277 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
low complexity region 438 447 N/A INTRINSIC
low complexity region 470 491 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 630 653 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177457
AA Change: Y928H

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134788
Gene: ENSMUSG00000026657
AA Change: Y928H

DomainStartEndE-ValueType
B41 16 221 3.24e-40 SMART
FERM_C 225 326 7.69e-27 SMART
Pfam:DUF3338 355 492 3.9e-63 PFAM
low complexity region 573 586 N/A INTRINSIC
low complexity region 625 638 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 800 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 939 962 N/A INTRINSIC
Meta Mutation Damage Score 0.1996 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.6%
  • 10x: 93.0%
  • 20x: 79.3%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a FERM domain-containing protein that regulates epithelial cell polarity. It connects ADP ribosylation factor 6 (ARF6) with the Par protein complex, which regulates the remodeling of adherens junctions and linear actin cable formation during epithelial cell polarization. Polymorphisms in this gene are associated with Alzheimer's disease, and also with nicotine dependence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,575,639 probably benign Het
Abcd4 T G 12: 84,612,352 Q210P possibly damaging Het
Ablim2 G A 5: 35,809,176 probably benign Het
Actl6b A G 5: 137,555,065 N113S probably benign Het
Actn3 A T 19: 4,871,615 V179E probably damaging Het
Aff4 C A 11: 53,415,466 T1145N probably damaging Het
Ankrd42 G A 7: 92,591,859 Q431* probably null Het
Anxa9 A G 3: 95,302,422 S129P probably benign Het
Arfgef2 T G 2: 166,835,719 I88S probably damaging Het
Asap3 C A 4: 136,234,604 N285K probably damaging Het
Atp6v0a2 A G 5: 124,713,184 N477S probably damaging Het
Atp7b C T 8: 22,028,172 E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 probably null Het
C87436 G A 6: 86,469,827 G533D probably damaging Het
Ccdc138 T A 10: 58,528,360 I314N probably damaging Het
Ccs A G 19: 4,825,626 F237S probably damaging Het
Ccz1 T G 5: 144,009,294 probably benign Het
Cdcp2 C T 4: 107,106,707 probably benign Het
Chd1 A G 17: 17,393,567 N531S probably damaging Het
Clptm1 A T 7: 19,635,007 F476I probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cped1 T A 6: 22,121,039 Y373N probably benign Het
Cr2 A T 1: 195,166,231 V328D probably damaging Het
D630045J12Rik A T 6: 38,149,771 probably benign Het
Dcdc2a A T 13: 25,187,672 probably benign Het
Dlg1 G T 16: 31,858,065 probably null Het
Epb41l5 A C 1: 119,549,902 V705G possibly damaging Het
Ergic3 C A 2: 156,011,140 R43S possibly damaging Het
Flnb T C 14: 7,901,951 V938A probably damaging Het
Fyn C T 10: 39,511,982 T78M probably benign Het
Gdap2 A G 3: 100,201,995 T443A probably damaging Het
Ghrl A T 6: 113,717,168 probably benign Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm12166 A G 11: 46,052,293 M1T probably null Het
Gm4787 T A 12: 81,377,747 K546* probably null Het
Gm498 G T 7: 143,891,755 G178C probably damaging Het
Gm6576 C G 15: 27,026,000 noncoding transcript Het
Got1 C T 19: 43,524,377 D27N probably benign Het
Gucy2c C T 6: 136,704,249 V946I probably damaging Het
Hectd4 T C 5: 121,349,243 Y3434H possibly damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Itpr1 A G 6: 108,471,209 probably benign Het
Kctd1 G A 18: 14,974,180 P743S probably benign Het
Klhl23 T C 2: 69,833,966 V553A probably damaging Het
Krt24 T C 11: 99,280,267 D495G probably damaging Het
L3hypdh C T 12: 72,077,143 probably null Het
Lipo3 C T 19: 33,557,106 probably null Het
Lman2l G T 1: 36,424,864 S171* probably null Het
Lrp1b T C 2: 41,511,508 D378G probably damaging Het
Map3k4 T A 17: 12,248,063 D1104V probably damaging Het
Mpeg1 T C 19: 12,461,223 V15A probably benign Het
Narf C T 11: 121,250,836 R356C probably damaging Het
Nebl T A 2: 17,393,023 Q487H possibly damaging Het
Olfm5 G A 7: 104,160,926 A76V probably benign Het
Olfr1090 T C 2: 86,753,887 M284V probably benign Het
Olfr339 T A 2: 36,422,287 D296E probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr656 A T 7: 104,618,581 I301F probably damaging Het
Olfr992 T A 2: 85,399,961 S191C probably damaging Het
Palb2 A T 7: 122,128,166 Y160* probably null Het
Paxip1 C T 5: 27,744,185 probably benign Het
Pclo A G 5: 14,679,797 probably benign Het
Pdcd11 G A 19: 47,119,862 V1223I probably benign Het
Pde6c T C 19: 38,169,365 probably benign Het
Prr12 A G 7: 45,050,039 probably benign Het
Prss39 T A 1: 34,502,200 probably benign Het
Samd5 A G 10: 9,674,939 W9R probably damaging Het
Sfr1 A G 19: 47,735,018 *320W probably null Het
Sh3bp4 A G 1: 89,145,314 N628S possibly damaging Het
Sim1 A T 10: 50,907,961 I104F probably damaging Het
Slc1a3 T C 15: 8,636,209 M519V probably benign Het
Smcp T A 3: 92,584,520 T7S unknown Het
Sp4 A G 12: 118,300,816 probably benign Het
Spag9 T A 11: 94,093,539 I327N probably damaging Het
Thbs4 G T 13: 92,754,410 H850N probably benign Het
Ubap2l A T 3: 90,021,373 S478T possibly damaging Het
Unc79 A G 12: 103,088,434 probably benign Het
Vmn2r85 A G 10: 130,419,185 probably benign Het
Wrap73 A G 4: 154,142,500 D19G possibly damaging Het
Other mutations in Frmd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Frmd4a APN 2 4594714 missense probably benign 0.00
IGL00508:Frmd4a APN 2 4594734 nonsense probably null
IGL01331:Frmd4a APN 2 4602225 missense probably benign 0.32
IGL01774:Frmd4a APN 2 4535236 splice site probably benign
IGL01909:Frmd4a APN 2 4604033 missense probably benign 0.11
IGL02170:Frmd4a APN 2 4566177 missense probably damaging 0.99
IGL02269:Frmd4a APN 2 4604234 missense probably benign 0.19
IGL02377:Frmd4a APN 2 4534574 missense possibly damaging 0.47
IGL03308:Frmd4a APN 2 4498026 missense possibly damaging 0.95
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0081:Frmd4a UTSW 2 4572441 critical splice donor site probably null
R0130:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0376:Frmd4a UTSW 2 4572387 missense probably damaging 0.97
R0529:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R0549:Frmd4a UTSW 2 4603967 missense possibly damaging 0.76
R1593:Frmd4a UTSW 2 4473188 missense probably damaging 1.00
R1959:Frmd4a UTSW 2 4535186 missense probably damaging 1.00
R2002:Frmd4a UTSW 2 4572365 missense probably damaging 1.00
R2100:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R2310:Frmd4a UTSW 2 4572399 frame shift probably null
R2340:Frmd4a UTSW 2 4586376 missense probably damaging 1.00
R2426:Frmd4a UTSW 2 4529862 missense probably damaging 1.00
R2680:Frmd4a UTSW 2 4534553 missense probably damaging 1.00
R3409:Frmd4a UTSW 2 4153028 intron probably benign
R3772:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3773:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3932:Frmd4a UTSW 2 4537260 missense probably damaging 1.00
R4094:Frmd4a UTSW 2 4611032 missense probably damaging 1.00
R4226:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4299:Frmd4a UTSW 2 4333071 missense probably benign 0.02
R4304:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4306:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4307:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4346:Frmd4a UTSW 2 4608033 missense possibly damaging 0.92
R4360:Frmd4a UTSW 2 4601241 missense probably damaging 1.00
R4384:Frmd4a UTSW 2 4594563 nonsense probably null
R4547:Frmd4a UTSW 2 4473145 missense probably damaging 1.00
R4575:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4577:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4578:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4688:Frmd4a UTSW 2 4537311 missense possibly damaging 0.81
R4764:Frmd4a UTSW 2 4603448 missense probably damaging 1.00
R4826:Frmd4a UTSW 2 4601297 missense probably damaging 1.00
R4879:Frmd4a UTSW 2 4529817 missense probably damaging 1.00
R5053:Frmd4a UTSW 2 4603921 missense probably damaging 1.00
R5392:Frmd4a UTSW 2 4594573 missense probably damaging 1.00
R5733:Frmd4a UTSW 2 4300957 missense possibly damaging 0.53
R5762:Frmd4a UTSW 2 4484065 missense probably damaging 1.00
R5920:Frmd4a UTSW 2 4333116 missense probably benign 0.02
R5932:Frmd4a UTSW 2 4529839 missense probably damaging 1.00
R6117:Frmd4a UTSW 2 4602249 missense possibly damaging 0.66
R6328:Frmd4a UTSW 2 4590698 missense probably damaging 0.99
R6622:Frmd4a UTSW 2 4606062 missense probably benign 0.00
R6903:Frmd4a UTSW 2 4586456 missense probably damaging 1.00
R7065:Frmd4a UTSW 2 4566112
R7098:Frmd4a UTSW 2 4572433 missense probably damaging 1.00
R7258:Frmd4a UTSW 2 4300953 missense probably benign
R7336:Frmd4a UTSW 2 4473214 missense possibly damaging 0.92
R7582:Frmd4a UTSW 2 4594597 frame shift probably null
R7583:Frmd4a UTSW 2 4594597 frame shift probably null
R7697:Frmd4a UTSW 2 4484081 missense probably damaging 1.00
R7750:Frmd4a UTSW 2 4601349 missense probably benign 0.14
R7795:Frmd4a UTSW 2 4590695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTCAAAGCGCAGTTTAAGACC -3'
(R):5'- GGCTTCCCACATTTCACAGCAAGG -3'

Sequencing Primer
(F):5'- GCAGTTTAAGACCTCCAACTCTTAC -3'
(R):5'- GGCCTCCAGAATAAGTGACTC -3'
Posted On2013-07-24