Incidental Mutation 'RF043:Rassf6'
ID 604910
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene Name Ras association (RalGDS/AF-6) domain family member 6
Synonyms 1600016B17Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # RF043 (G1)
Quality Score 211.468
Status Not validated
Chromosome 5
Chromosomal Location 90750935-90788516 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) AATGGGGATTC to AATGGGGATTCTGCCTCACTCATGGTCCTGTAGAGCCATGGGGATTC at 90756791 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000202704] [ENSMUST00000202784]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031317
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202704
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202784
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202807
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 GCGGCGGCGGCGAC GC 2: 25,162,573 (GRCm39) probably benign Het
Ankhd1 CGGCGG CGGCGGTGGCGG 18: 36,693,970 (GRCm39) probably benign Het
Btnl10 CAAA CAAAAAA 11: 58,814,752 (GRCm39) probably benign Het
Cpne1 TCCAC TC 2: 155,915,430 (GRCm39) probably benign Het
Cyb5r4 ACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 86,922,464 (GRCm39) probably benign Het
Cyb5r4 AGACACACTGCCCAGGGA AGACACACTGCCCAGGGATGTGACCGACACACTGCCCAGGGA 9: 86,922,484 (GRCm39) probably benign Het
Dbr1 GAGGAG GAGGAGCAGGAG 9: 99,465,750 (GRCm39) probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,327,753 (GRCm39) probably benign Het
Emid1 G T 11: 5,094,322 (GRCm39) P63Q probably damaging Het
Gabre GCTCCG GCTCCGACTCCG X: 71,313,654 (GRCm39) probably benign Het
Gar1 AACTGCC A 3: 129,624,337 (GRCm39) probably benign Het
Gm10181 GAGAGAGAGAGAGA G 9: 25,000,755 (GRCm39) probably null Het
Hic1 GGGA G 11: 75,060,281 (GRCm39) probably benign Het
Il2 GG GGGCTTGAAGTGTG 3: 37,179,991 (GRCm39) probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCGTTTTCCTTTT 9: 106,447,812 (GRCm39) probably benign Het
Irag2 TG TGAGCACATGG 6: 145,119,516 (GRCm39) probably benign Het
Krtap4-2 AGGGGCGGCAGC A 11: 99,525,547 (GRCm39) probably null Het
Lmx1b CATCTTGATGCCGTCCAA CA 2: 33,530,521 (GRCm39) probably null Het
Lrch1 TGGTGGTG T 14: 75,185,015 (GRCm39) probably null Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAAGA 11: 58,281,069 (GRCm39) probably benign Het
Mamld1 AGC AGCTGC X: 70,162,441 (GRCm39) probably benign Het
Mrgprx1 GAAC GAACAAC 7: 47,671,257 (GRCm39) probably benign Het
Nefh CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA CTTGGCCTCACCTGGGGAATTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA 11: 4,891,016 (GRCm39) probably benign Het
Nusap1 AGTGAGGAGCAAGCTGAGA AGTGAGGAGCAAGCTGAGATACACGTTAGCCGTGAGGAGCAAGCTGAGA 2: 119,458,073 (GRCm39) probably benign Het
P4ha2 GGTGTTG GG 11: 54,001,076 (GRCm39) probably null Het
Padi3 TCTCAC TC 4: 140,520,283 (GRCm39) probably benign Het
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,468,290 (GRCm39) probably benign Het
Ptms TCCTCCTC TCCTCCTCCTC 6: 124,891,411 (GRCm39) probably benign Het
Rgs22 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAA 15: 36,010,982 (GRCm39) probably benign Het
Rnf144a TCTC TCTCTCTCTCTCTCGCTC 12: 26,364,013 (GRCm39) probably benign Het
Rpgrip1 GAG GAGAAG 14: 52,386,852 (GRCm39) probably benign Het
Sgpp1 ACACAC A 12: 75,769,399 (GRCm39) probably null Het
Slc39a4 GTC GTCATCATGATCACCATGGTCACCATGATCGCTGTGTTC 15: 76,499,070 (GRCm39) probably benign Het
Spaca1 TCTCGC TCTCGCGCTCGC 4: 34,049,846 (GRCm39) probably benign Het
Stard8 GGA GGATGA X: 98,110,126 (GRCm39) probably benign Het
Stard8 GA GAGCA X: 98,110,133 (GRCm39) probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGAAGGGCACTTTCCCAGGGATCCCCTTGGC 18: 60,966,644 (GRCm39) probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGCGGGCTTG 6: 72,593,019 (GRCm39) probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCGCCCGTGGTCTTGCCAGAAT 6: 72,593,046 (GRCm39) probably benign Het
Tmed6 AGC AGCTCGC 8: 107,788,228 (GRCm39) probably null Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,673,154 (GRCm39) probably benign Het
Zfp933 TT TTTGCCT 4: 147,910,188 (GRCm39) probably null Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90,751,999 (GRCm39) missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90,751,930 (GRCm39) missense probably benign 0.03
IGL01139:Rassf6 APN 5 90,756,825 (GRCm39) makesense probably null
IGL03114:Rassf6 APN 5 90,756,649 (GRCm39) splice site probably benign
R1956:Rassf6 UTSW 5 90,763,730 (GRCm39) nonsense probably null
R2167:Rassf6 UTSW 5 90,751,797 (GRCm39) missense probably damaging 1.00
R2351:Rassf6 UTSW 5 90,779,418 (GRCm39) missense probably benign 0.05
R2877:Rassf6 UTSW 5 90,754,664 (GRCm39) missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90,757,646 (GRCm39) missense probably damaging 1.00
R5134:Rassf6 UTSW 5 90,752,225 (GRCm39) critical splice acceptor site probably null
R5153:Rassf6 UTSW 5 90,754,699 (GRCm39) missense possibly damaging 0.81
R5633:Rassf6 UTSW 5 90,751,977 (GRCm39) missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90,765,627 (GRCm39) missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90,751,736 (GRCm39) missense probably damaging 1.00
R6746:Rassf6 UTSW 5 90,757,633 (GRCm39) missense possibly damaging 0.80
R7038:Rassf6 UTSW 5 90,757,584 (GRCm39) missense probably benign 0.13
R7190:Rassf6 UTSW 5 90,754,666 (GRCm39) missense probably damaging 1.00
R7549:Rassf6 UTSW 5 90,754,661 (GRCm39) missense probably damaging 1.00
R8497:Rassf6 UTSW 5 90,779,391 (GRCm39) missense possibly damaging 0.83
R9472:Rassf6 UTSW 5 90,765,572 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,784 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF004:Rassf6 UTSW 5 90,756,778 (GRCm39) utr 3 prime probably benign
RF011:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90,756,800 (GRCm39) utr 3 prime probably benign
RF018:Rassf6 UTSW 5 90,756,788 (GRCm39) utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,776 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,771 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90,756,767 (GRCm39) utr 3 prime probably benign
RF036:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90,756,789 (GRCm39) utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90,756,772 (GRCm39) utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90,756,788 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,775 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,790 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,770 (GRCm39) utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90,756,801 (GRCm39) nonsense probably null
X0017:Rassf6 UTSW 5 90,754,648 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTAGGCATCTGCTACCGC -3'
(R):5'- AGCCAGGAAATAGCAGTCATTC -3'

Sequencing Primer
(F):5'- CCGCTGTTATTACTAACTTGAATGC -3'
(R):5'- TCTTGTTAATAAAAGCACGCCAGCG -3'
Posted On 2019-12-04