Incidental Mutation 'RF043:Mrgprx1'
ID604916
Institutional Source Beutler Lab
Gene Symbol Mrgprx1
Ensembl Gene ENSMUSG00000070552
Gene NameMAS-related GPR, member X1
SynonymsMrgprc11, MrgC11
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF043 (G1)
Quality Score117.592
Status Not validated
Chromosome7
Chromosomal Location48020971-48027597 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GAAC to GAACAAC at 48021509 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094390]
Predicted Effect probably benign
Transcript: ENSMUST00000094390
SMART Domains Protein: ENSMUSP00000091954
Gene: ENSMUSG00000070552

DomainStartEndE-ValueType
Pfam:7tm_1 43 202 1.9e-7 PFAM
low complexity region 227 245 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Ankhd1 CGGCGG CGGCGGTGGCGG 18: 36,560,917 probably benign Het
Btnl10 CAAA CAAAAAA 11: 58,923,926 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Cyb5r4 ACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,411 probably benign Het
Cyb5r4 AGACACACTGCCCAGGGA AGACACACTGCCCAGGGATGTGACCGACACACTGCCCAGGGA 9: 87,040,431 probably benign Het
Dbr1 GAGGAG GAGGAGCAGGAG 9: 99,583,697 probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,485,833 probably benign Het
Emid1 G T 11: 5,144,322 P63Q probably damaging Het
Gabre GCTCCG GCTCCGACTCCG X: 72,270,048 probably benign Het
Gar1 AACTGCC A 3: 129,830,688 probably benign Het
Gm10181 GAGAGAGAGAGAGA G 9: 25,089,459 probably null Het
Hic1 GGGA G 11: 75,169,455 probably benign Het
Il2 GG GGGCTTGAAGTGTG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCGTTTTCCTTTT 9: 106,570,613 probably benign Het
Krtap4-2 AGGGGCGGCAGC A 11: 99,634,721 probably null Het
Lmx1b CATCTTGATGCCGTCCAA CA 2: 33,640,509 probably null Het
Lrch1 TGGTGGTG T 14: 74,947,575 probably null Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAAGA 11: 58,390,243 probably benign Het
Mamld1 AGC AGCTGC X: 71,118,835 probably benign Het
Nefh CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA CTTGGCCTCACCTGGGGAATTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA 11: 4,941,016 probably benign Het
Nusap1 AGTGAGGAGCAAGCTGAGA AGTGAGGAGCAAGCTGAGATACACGTTAGCCGTGAGGAGCAAGCTGAGA 2: 119,627,592 probably benign Het
P4ha2 GGTGTTG GG 11: 54,110,250 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Het
Ptms TCCTCCTC TCCTCCTCCTC 6: 124,914,448 probably benign Het
Rassf6 AATGGGGATTC AATGGGGATTCTGCCTCACTCATGGTCCTGTAGAGCCATGGGGATTC 5: 90,608,932 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCAGGGTCCTGTAGAGCAATGGGGCTTC 5: 90,608,939 probably benign Het
Rgs22 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAA 15: 36,010,836 probably benign Het
Rnf144a TCTC TCTCTCTCTCTCTCGCTC 12: 26,314,014 probably benign Het
Rpgrip1 GAG GAGAAG 14: 52,149,395 probably benign Het
Sgpp1 ACACAC A 12: 75,722,625 probably null Het
Slc39a4 GTC GTCATCATGATCACCATGGTCACCATGATCGCTGTGTTC 15: 76,614,870 probably benign Het
Spaca1 TCTCGC TCTCGCGCTCGC 4: 34,049,846 probably benign Het
Stard8 GGA GGATGA X: 99,066,520 probably benign Het
Stard8 GA GAGCA X: 99,066,527 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGAAGGGCACTTTCCCAGGGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGCGGGCTTG 6: 72,616,036 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCGCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Tmed6 AGC AGCTCGC 8: 107,061,596 probably null Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,305 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Mrgprx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Mrgprx1 APN 7 48021486 missense probably benign 0.00
IGL01326:Mrgprx1 APN 7 48021769 missense probably benign 0.26
IGL02117:Mrgprx1 APN 7 48021623 nonsense probably null
IGL02219:Mrgprx1 APN 7 48021729 missense probably benign 0.20
IGL02431:Mrgprx1 APN 7 48021127 missense probably benign 0.00
IGL02441:Mrgprx1 APN 7 48021588 missense probably benign 0.39
IGL02682:Mrgprx1 APN 7 48021992 missense probably damaging 1.00
R0219:Mrgprx1 UTSW 7 48021546 missense probably damaging 1.00
R4366:Mrgprx1 UTSW 7 48021193 missense probably damaging 0.98
R4521:Mrgprx1 UTSW 7 48021699 missense probably benign
R4801:Mrgprx1 UTSW 7 48021211 missense possibly damaging 0.89
R4802:Mrgprx1 UTSW 7 48021211 missense possibly damaging 0.89
R5452:Mrgprx1 UTSW 7 48021808 missense probably benign 0.07
R5537:Mrgprx1 UTSW 7 48021150 missense probably benign
R6444:Mrgprx1 UTSW 7 48021814 missense possibly damaging 0.87
R6834:Mrgprx1 UTSW 7 48021637 missense probably damaging 0.99
R7406:Mrgprx1 UTSW 7 48021985 missense possibly damaging 0.62
RF020:Mrgprx1 UTSW 7 48021511 small insertion probably benign
RF024:Mrgprx1 UTSW 7 48021511 small insertion probably benign
RF026:Mrgprx1 UTSW 7 48021509 small insertion probably benign
Z1088:Mrgprx1 UTSW 7 48021129 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTAACATACAGCCTGGACAG -3'
(R):5'- ACGGATCATTGACTTCTATGGCC -3'

Sequencing Primer
(F):5'- TGGACAGGGGTTTCCTCC -3'
(R):5'- TCTTAGGCAATGCAGCAATCATC -3'
Posted On2019-12-04