Incidental Mutation 'R0128:Nebl'
ID60492
Institutional Source Beutler Lab
Gene Symbol Nebl
Ensembl Gene ENSMUSG00000053702
Gene Namenebulette
SynonymsLnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
MMRRC Submission 038413-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0128 (G1)
Quality Score156
Status Validated
Chromosome2
Chromosomal Location17343909-17731464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17393023 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 487 (Q487H)
Ref Sequence ENSEMBL: ENSMUSP00000118525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028080] [ENSMUST00000124270] [ENSMUST00000131957] [ENSMUST00000132418] [ENSMUST00000145492] [ENSMUST00000177966]
Predicted Effect probably benign
Transcript: ENSMUST00000028080
SMART Domains Protein: ENSMUSP00000028080
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
LIM 4 56 6.95e-14 SMART
NEBU 62 92 3.35e-8 SMART
NEBU 98 128 4.88e-10 SMART
NEBU 134 164 3.82e-3 SMART
SH3 213 270 2.12e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000124270
AA Change: Q522H

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117805
Gene: ENSMUSG00000053702
AA Change: Q522H

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 1.57e0 SMART
NEBU 280 310 9.67e-1 SMART
NEBU 315 345 6.25e-8 SMART
NEBU 351 381 5.97e-5 SMART
NEBU 387 418 2.56e-4 SMART
NEBU 425 455 8.91e-4 SMART
NEBU 462 492 4.92e-6 SMART
NEBU 499 529 2.33e-7 SMART
NEBU 536 566 1.84e-5 SMART
NEBU 571 601 2.23e-4 SMART
NEBU 602 632 1.24e-2 SMART
NEBU 664 694 6.6e-7 SMART
NEBU 695 725 6.86e-5 SMART
NEBU 726 756 2.03e-7 SMART
NEBU 761 791 1.74e-6 SMART
NEBU 797 827 3.82e-3 SMART
SH3 957 1014 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124611
SMART Domains Protein: ENSMUSP00000116065
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
NEBU 3 33 4.88e-10 SMART
NEBU 39 69 3.82e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127912
Predicted Effect possibly damaging
Transcript: ENSMUST00000131957
AA Change: Q487H

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118525
Gene: ENSMUSG00000053702
AA Change: Q487H

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 8.91e-4 SMART
NEBU 427 457 4.92e-6 SMART
NEBU 464 494 2.33e-7 SMART
NEBU 501 525 1.02e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132418
SMART Domains Protein: ENSMUSP00000122024
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 4.78e-4 SMART
NEBU 427 450 6.81e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137253
Predicted Effect probably benign
Transcript: ENSMUST00000145492
SMART Domains Protein: ENSMUSP00000121313
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 8.91e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150194
Predicted Effect probably benign
Transcript: ENSMUST00000177966
SMART Domains Protein: ENSMUSP00000137567
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
NEBU 5 35 2.23e-4 SMART
NEBU 36 66 3.28e-2 SMART
NEBU 67 97 6.6e-7 SMART
NEBU 98 120 2e1 SMART
Meta Mutation Damage Score 0.0735 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.6%
  • 10x: 93.0%
  • 20x: 79.3%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,575,639 probably benign Het
Abcd4 T G 12: 84,612,352 Q210P possibly damaging Het
Ablim2 G A 5: 35,809,176 probably benign Het
Actl6b A G 5: 137,555,065 N113S probably benign Het
Actn3 A T 19: 4,871,615 V179E probably damaging Het
Aff4 C A 11: 53,415,466 T1145N probably damaging Het
Ankrd42 G A 7: 92,591,859 Q431* probably null Het
Anxa9 A G 3: 95,302,422 S129P probably benign Het
Arfgef2 T G 2: 166,835,719 I88S probably damaging Het
Asap3 C A 4: 136,234,604 N285K probably damaging Het
Atp6v0a2 A G 5: 124,713,184 N477S probably damaging Het
Atp7b C T 8: 22,028,172 E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 probably null Het
C87436 G A 6: 86,469,827 G533D probably damaging Het
Ccdc138 T A 10: 58,528,360 I314N probably damaging Het
Ccs A G 19: 4,825,626 F237S probably damaging Het
Ccz1 T G 5: 144,009,294 probably benign Het
Cdcp2 C T 4: 107,106,707 probably benign Het
Chd1 A G 17: 17,393,567 N531S probably damaging Het
Clptm1 A T 7: 19,635,007 F476I probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cped1 T A 6: 22,121,039 Y373N probably benign Het
Cr2 A T 1: 195,166,231 V328D probably damaging Het
D630045J12Rik A T 6: 38,149,771 probably benign Het
Dcdc2a A T 13: 25,187,672 probably benign Het
Dlg1 G T 16: 31,858,065 probably null Het
Epb41l5 A C 1: 119,549,902 V705G possibly damaging Het
Ergic3 C A 2: 156,011,140 R43S possibly damaging Het
Flnb T C 14: 7,901,951 V938A probably damaging Het
Frmd4a T C 2: 4,604,092 Y928H probably damaging Het
Fyn C T 10: 39,511,982 T78M probably benign Het
Gdap2 A G 3: 100,201,995 T443A probably damaging Het
Ghrl A T 6: 113,717,168 probably benign Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm12166 A G 11: 46,052,293 M1T probably null Het
Gm4787 T A 12: 81,377,747 K546* probably null Het
Gm498 G T 7: 143,891,755 G178C probably damaging Het
Gm6576 C G 15: 27,026,000 noncoding transcript Het
Got1 C T 19: 43,524,377 D27N probably benign Het
Gucy2c C T 6: 136,704,249 V946I probably damaging Het
Hectd4 T C 5: 121,349,243 Y3434H possibly damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Itpr1 A G 6: 108,471,209 probably benign Het
Kctd1 G A 18: 14,974,180 P743S probably benign Het
Klhl23 T C 2: 69,833,966 V553A probably damaging Het
Krt24 T C 11: 99,280,267 D495G probably damaging Het
L3hypdh C T 12: 72,077,143 probably null Het
Lipo3 C T 19: 33,557,106 probably null Het
Lman2l G T 1: 36,424,864 S171* probably null Het
Lrp1b T C 2: 41,511,508 D378G probably damaging Het
Map3k4 T A 17: 12,248,063 D1104V probably damaging Het
Mpeg1 T C 19: 12,461,223 V15A probably benign Het
Narf C T 11: 121,250,836 R356C probably damaging Het
Olfm5 G A 7: 104,160,926 A76V probably benign Het
Olfr1090 T C 2: 86,753,887 M284V probably benign Het
Olfr339 T A 2: 36,422,287 D296E probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr656 A T 7: 104,618,581 I301F probably damaging Het
Olfr992 T A 2: 85,399,961 S191C probably damaging Het
Palb2 A T 7: 122,128,166 Y160* probably null Het
Paxip1 C T 5: 27,744,185 probably benign Het
Pclo A G 5: 14,679,797 probably benign Het
Pdcd11 G A 19: 47,119,862 V1223I probably benign Het
Pde6c T C 19: 38,169,365 probably benign Het
Prr12 A G 7: 45,050,039 probably benign Het
Prss39 T A 1: 34,502,200 probably benign Het
Samd5 A G 10: 9,674,939 W9R probably damaging Het
Sfr1 A G 19: 47,735,018 *320W probably null Het
Sh3bp4 A G 1: 89,145,314 N628S possibly damaging Het
Sim1 A T 10: 50,907,961 I104F probably damaging Het
Slc1a3 T C 15: 8,636,209 M519V probably benign Het
Smcp T A 3: 92,584,520 T7S unknown Het
Sp4 A G 12: 118,300,816 probably benign Het
Spag9 T A 11: 94,093,539 I327N probably damaging Het
Thbs4 G T 13: 92,754,410 H850N probably benign Het
Ubap2l A T 3: 90,021,373 S478T possibly damaging Het
Unc79 A G 12: 103,088,434 probably benign Het
Vmn2r85 A G 10: 130,419,185 probably benign Het
Wrap73 A G 4: 154,142,500 D19G possibly damaging Het
Other mutations in Nebl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Nebl APN 2 17348868 missense probably damaging 0.99
IGL02732:Nebl APN 2 17452484 splice site probably benign
IGL03241:Nebl APN 2 17393164 critical splice donor site probably null
IGL03334:Nebl APN 2 17413711 missense probably damaging 0.98
R0068:Nebl UTSW 2 17434971 nonsense probably null
R0127:Nebl UTSW 2 17392983 missense probably benign 0.31
R0130:Nebl UTSW 2 17390926 start gained probably benign
R0130:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0537:Nebl UTSW 2 17404215 missense possibly damaging 0.62
R0743:Nebl UTSW 2 17411118 missense probably benign
R0884:Nebl UTSW 2 17411118 missense probably benign
R1364:Nebl UTSW 2 17393037 unclassified probably benign
R1638:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R1711:Nebl UTSW 2 17388754 missense probably damaging 0.96
R1933:Nebl UTSW 2 17375292 missense probably damaging 0.97
R1990:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1991:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1992:Nebl UTSW 2 17452510 missense probably damaging 0.98
R2062:Nebl UTSW 2 17397121 missense probably benign 0.39
R2183:Nebl UTSW 2 17404216 missense probably damaging 0.99
R2325:Nebl UTSW 2 17393016 missense possibly damaging 0.79
R2679:Nebl UTSW 2 17424591 missense probably benign 0.03
R2877:Nebl UTSW 2 17434929 missense probably damaging 0.99
R2878:Nebl UTSW 2 17434929 missense probably damaging 0.99
R3079:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3080:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3878:Nebl UTSW 2 17393252 missense possibly damaging 0.83
R3947:Nebl UTSW 2 17378106 critical splice donor site probably null
R4983:Nebl UTSW 2 17375271 missense possibly damaging 0.80
R5006:Nebl UTSW 2 17388771 unclassified probably null
R5256:Nebl UTSW 2 17433975 missense probably benign 0.37
R5491:Nebl UTSW 2 17434972 nonsense probably null
R5533:Nebl UTSW 2 17393268 nonsense probably null
R5597:Nebl UTSW 2 17378167 missense probably benign
R5658:Nebl UTSW 2 17348852 missense probably damaging 1.00
R5933:Nebl UTSW 2 17404187 missense probably benign
R6056:Nebl UTSW 2 17450234 missense probably benign 0.13
R6161:Nebl UTSW 2 17730830 missense probably benign 0.26
R6646:Nebl UTSW 2 17376685 missense probably damaging 1.00
R6784:Nebl UTSW 2 17434914 nonsense probably null
R6935:Nebl UTSW 2 17348826 missense probably damaging 1.00
R7196:Nebl UTSW 2 17452518 missense probably damaging 1.00
R7671:Nebl UTSW 2 17390916 nonsense probably null
R7728:Nebl UTSW 2 17370514 missense
X0012:Nebl UTSW 2 17443794 missense probably benign 0.16
X0025:Nebl UTSW 2 17404267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGGGACTTTGGCATCTCATAAC -3'
(R):5'- TGTCCAGAGAGCTAAGAGGGCATC -3'

Sequencing Primer
(F):5'- TGGCATCTCATAACGGCTAC -3'
(R):5'- AGGGCATCCGAGATGGC -3'
Posted On2013-07-24