Incidental Mutation 'RF043:Rnf144a'
ID604930
Institutional Source Beutler Lab
Gene Symbol Rnf144a
Ensembl Gene ENSMUSG00000020642
Gene Namering finger protein 144A
SynonymsUIP4, Rnf144
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF043 (G1)
Quality Score121.467
Status Not validated
Chromosome12
Chromosomal Location26300964-26415254 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) TCTC to TCTCTCTCTCTCTCGCTC at 26314014 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020971] [ENSMUST00000062149]
Predicted Effect probably benign
Transcript: ENSMUST00000020971
SMART Domains Protein: ENSMUSP00000020971
Gene: ENSMUSG00000020642

DomainStartEndE-ValueType
RING 20 68 2.17e-1 SMART
IBR 91 156 6.4e-19 SMART
IBR 168 232 9.16e-1 SMART
RING 185 280 1.58e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062149
SMART Domains Protein: ENSMUSP00000056073
Gene: ENSMUSG00000020642

DomainStartEndE-ValueType
RING 20 68 2.17e-1 SMART
IBR 91 156 6.4e-19 SMART
IBR 168 232 9.16e-1 SMART
RING 185 280 1.58e0 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of RING finger domain-containing E3 ubiquitin ligases that also includes parkin and parc. The expression of this gene is induced by DNA damage. The encoded protein interacts with the cytoplasmic DNA-dependent protein kinase, catalytic subunit (DNA-PKcs) and promotes its degradation through ubiquitination. The orthologous mouse protein has been shown to interact with a ubiquitin-conjugating enzyme involved in embryonic development. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Ankhd1 CGGCGG CGGCGGTGGCGG 18: 36,560,917 probably benign Het
Btnl10 CAAA CAAAAAA 11: 58,923,926 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Cyb5r4 ACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,411 probably benign Het
Cyb5r4 AGACACACTGCCCAGGGA AGACACACTGCCCAGGGATGTGACCGACACACTGCCCAGGGA 9: 87,040,431 probably benign Het
Dbr1 GAGGAG GAGGAGCAGGAG 9: 99,583,697 probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,485,833 probably benign Het
Emid1 G T 11: 5,144,322 P63Q probably damaging Het
Gabre GCTCCG GCTCCGACTCCG X: 72,270,048 probably benign Het
Gar1 AACTGCC A 3: 129,830,688 probably benign Het
Gm10181 GAGAGAGAGAGAGA G 9: 25,089,459 probably null Het
Hic1 GGGA G 11: 75,169,455 probably benign Het
Il2 GG GGGCTTGAAGTGTG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCGTTTTCCTTTT 9: 106,570,613 probably benign Het
Krtap4-2 AGGGGCGGCAGC A 11: 99,634,721 probably null Het
Lmx1b CATCTTGATGCCGTCCAA CA 2: 33,640,509 probably null Het
Lrch1 TGGTGGTG T 14: 74,947,575 probably null Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAAGA 11: 58,390,243 probably benign Het
Mamld1 AGC AGCTGC X: 71,118,835 probably benign Het
Mrgprx1 GAAC GAACAAC 7: 48,021,509 probably benign Het
Nefh CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA CTTGGCCTCACCTGGGGAATTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA 11: 4,941,016 probably benign Het
Nusap1 AGTGAGGAGCAAGCTGAGA AGTGAGGAGCAAGCTGAGATACACGTTAGCCGTGAGGAGCAAGCTGAGA 2: 119,627,592 probably benign Het
P4ha2 GGTGTTG GG 11: 54,110,250 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Het
Ptms TCCTCCTC TCCTCCTCCTC 6: 124,914,448 probably benign Het
Rassf6 AATGGGGATTC AATGGGGATTCTGCCTCACTCATGGTCCTGTAGAGCCATGGGGATTC 5: 90,608,932 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCAGGGTCCTGTAGAGCAATGGGGCTTC 5: 90,608,939 probably benign Het
Rgs22 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAA 15: 36,010,836 probably benign Het
Rpgrip1 GAG GAGAAG 14: 52,149,395 probably benign Het
Sgpp1 ACACAC A 12: 75,722,625 probably null Het
Slc39a4 GTC GTCATCATGATCACCATGGTCACCATGATCGCTGTGTTC 15: 76,614,870 probably benign Het
Spaca1 TCTCGC TCTCGCGCTCGC 4: 34,049,846 probably benign Het
Stard8 GGA GGATGA X: 99,066,520 probably benign Het
Stard8 GA GAGCA X: 99,066,527 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGAAGGGCACTTTCCCAGGGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGCGGGCTTG 6: 72,616,036 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCGCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Tmed6 AGC AGCTCGC 8: 107,061,596 probably null Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,305 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Rnf144a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Rnf144a APN 12 26327301 missense probably benign 0.01
IGL02709:Rnf144a APN 12 26321010 missense probably damaging 1.00
R0432:Rnf144a UTSW 12 26339329 missense probably damaging 1.00
R3897:Rnf144a UTSW 12 26310713 missense probably damaging 1.00
R4087:Rnf144a UTSW 12 26327592 missense probably damaging 1.00
R4504:Rnf144a UTSW 12 26327303 missense probably benign 0.11
R5985:Rnf144a UTSW 12 26317780 missense probably benign 0.04
R6392:Rnf144a UTSW 12 26310780 missense possibly damaging 0.93
R7827:Rnf144a UTSW 12 26339440 start codon destroyed probably null 0.89
R8431:Rnf144a UTSW 12 26327301 missense probably damaging 1.00
RF018:Rnf144a UTSW 12 26314014 critical splice donor site probably benign
RF036:Rnf144a UTSW 12 26314008 critical splice donor site probably benign
RF036:Rnf144a UTSW 12 26314013 critical splice donor site probably benign
RF048:Rnf144a UTSW 12 26314011 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- CTAGAAAACACATTCCTGTCTTCTG -3'
(R):5'- CACCGGGTATCTGGAAAGATC -3'

Sequencing Primer
(F):5'- ACACATTCCTGTCTTCTGAAAAATAC -3'
(R):5'- AGATCAAACAAACTGAAGCGTTC -3'
Posted On2019-12-04