Incidental Mutation 'RF044:Ren1'
Institutional Source Beutler Lab
Gene Symbol Ren1
Ensembl Gene ENSMUSG00000070645
Gene Namerenin 1 structural
SynonymsRen-1, Ren1d, Ren1c, Ren, Ren-A, Rnr, Rn-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF044 (G1)
Quality Score126.467
Status Not validated
Chromosomal Location133350510-133360325 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) ACCGC to AC at 133350781 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094556] [ENSMUST00000112287]
Predicted Effect probably benign
Transcript: ENSMUST00000094556
SMART Domains Protein: ENSMUSP00000092135
Gene: ENSMUSG00000070645

signal peptide 1 21 N/A INTRINSIC
Pfam:A1_Propeptide 29 54 1.2e-10 PFAM
Pfam:Asp 83 401 1.3e-120 PFAM
Pfam:TAXi_C 261 400 1.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112287
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Renin catalyzes the first step in the activation pathway of angiotensinogen--a cascade that can result in aldosterone release,vasoconstriction, and increase in blood pressure. Renin, an aspartyl protease, cleaves angiotensinogen to form angiotensin I, which is converted to angiotensin II by angiotensin I converting enzyme, an important regulator of blood pressure and electrolyte balance. Transcript variants that encode different protein isoforms and that arise from alternative splicing and the use of alternative promoters have been described, but their full-length nature has not been determined. Mutations in this gene have been shown to cause familial hyperproreninemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to postnatal lethality, reduced plasma renin level, decreased mean arterial pressure, and kidney defects such as atrophy, altered juxtaglomerular cell and macula densa morphology, polyuria, decreased urine osmolality, and reduced glomerular filtration rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TG TGTGGCTGCCG 1: 82,913,589 probably benign Het
Blm CTCC CTCCTCCTCCTCATCC 7: 80,512,930 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,057 probably null Het
Ccdc85c GCC GCCACC 12: 108,274,612 probably benign Het
Chga AGC AGCGGC 12: 102,561,396 probably benign Het
Crtam TTCTTGATCTGAA T 9: 40,984,354 probably null Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,768 probably benign Het
F830016B08Rik AAAAAA AAAAAAAAA 18: 60,299,938 probably benign Het
Gab3 TCT TCTCCT X: 75,000,005 probably benign Het
Gabre CTC CTCCGGATC X: 72,270,061 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,131 probably benign Het
Lrmp TG TGAGCACATCG 6: 145,173,790 probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Morn4 GTGAG GTGAGTCAAGCATTGAG 19: 42,076,114 probably null Het
Nolc1 CAGCAGC CAGCAGCAGAAGCAGC 19: 46,081,371 probably benign Het
Olfr964-ps1 AAAATA AAAATAAATA 9: 39,686,747 probably null Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Pla2g4e AGGG A 2: 120,244,724 probably benign Het
Ptdss1 G T 13: 66,945,348 S84I possibly damaging Het
Rinl G T 7: 28,797,563 G496V probably damaging Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sbp A AAAAAGATGATGACAC 17: 23,945,366 probably benign Het
Spaca1 TCTCGC TCTCGCGCTCGC 4: 34,049,846 probably benign Het
Spaca1 TCGC TCGCTCGCGC 4: 34,049,854 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 GCA GCAACA 11: 94,214,461 probably benign Het
Zfp683 TGTGG TGTGGTGG 4: 134,058,874 probably benign Het
Other mutations in Ren1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Ren1 APN 1 133358412 missense probably benign 0.00
IGL02172:Ren1 APN 1 133359033 missense possibly damaging 0.95
IGL02686:Ren1 APN 1 133358469 missense possibly damaging 0.86
3_musketeers UTSW 1 133354808 missense probably damaging 1.00
quieted UTSW 1 133350796 nonsense probably null
snickers UTSW 1 133356518 missense probably damaging 1.00
R0268:Ren1 UTSW 1 133355611 missense possibly damaging 0.74
R1115:Ren1 UTSW 1 133356518 missense probably damaging 1.00
R1728:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1728:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1728:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1728:Ren1 UTSW 1 133358982 splice site probably null
R1728:Ren1 UTSW 1 133359079 missense probably benign
R1728:Ren1 UTSW 1 133359983 missense probably benign
R1728:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1729:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1729:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1729:Ren1 UTSW 1 133359079 missense probably benign
R1729:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1730:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1730:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1730:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1730:Ren1 UTSW 1 133359079 missense probably benign
R1730:Ren1 UTSW 1 133359983 missense probably benign
R1730:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1739:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1739:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1739:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1739:Ren1 UTSW 1 133359079 missense probably benign
R1739:Ren1 UTSW 1 133359983 missense probably benign
R1739:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1762:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1762:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1762:Ren1 UTSW 1 133358982 splice site probably null
R1762:Ren1 UTSW 1 133359079 missense probably benign
R1762:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1783:Ren1 UTSW 1 133350778 splice site probably null
R1783:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1783:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1783:Ren1 UTSW 1 133359079 missense probably benign
R1783:Ren1 UTSW 1 133359983 missense probably benign
R1783:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1784:Ren1 UTSW 1 133350778 splice site probably null
R1784:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1784:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1784:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1784:Ren1 UTSW 1 133359079 missense probably benign
R1784:Ren1 UTSW 1 133359983 missense probably benign
R1784:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1785:Ren1 UTSW 1 133350778 splice site probably null
R1785:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1785:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1785:Ren1 UTSW 1 133359079 missense probably benign
R1785:Ren1 UTSW 1 133359983 missense probably benign
R1785:Ren1 UTSW 1 133360007 missense probably benign 0.02
R2049:Ren1 UTSW 1 133350778 splice site probably null
R2130:Ren1 UTSW 1 133350778 splice site probably null
R2131:Ren1 UTSW 1 133350778 splice site probably null
R2133:Ren1 UTSW 1 133358982 splice site probably null
R2141:Ren1 UTSW 1 133350778 splice site probably null
R2142:Ren1 UTSW 1 133350778 splice site probably null
R2518:Ren1 UTSW 1 133360124 missense probably damaging 1.00
R4361:Ren1 UTSW 1 133359041 missense probably benign
R4584:Ren1 UTSW 1 133354808 missense probably damaging 1.00
R5188:Ren1 UTSW 1 133350613 unclassified probably benign
R5806:Ren1 UTSW 1 133355511 nonsense probably null
R7999:Ren1 UTSW 1 133354866 missense probably damaging 1.00
R8093:Ren1 UTSW 1 133360074 missense probably damaging 1.00
R8175:Ren1 UTSW 1 133354269 missense possibly damaging 0.94
R8259:Ren1 UTSW 1 133350796 nonsense probably null
RF037:Ren1 UTSW 1 133350781 unclassified probably benign
Z1177:Ren1 UTSW 1 133350750 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04