Incidental Mutation 'RF044:Pla2g4e'
ID 604948
Institutional Source Beutler Lab
Gene Symbol Pla2g4e
Ensembl Gene ENSMUSG00000050211
Gene Name phospholipase A2, group IVE
Synonyms Pla2epsilon, 2310026J01Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF044 (G1)
Quality Score 122.457
Status Not validated
Chromosome 2
Chromosomal Location 119996893-120075816 bp(-) (GRCm39)
Type of Mutation small deletion (1 aa in frame mutation)
DNA Base Change (assembly) AGGG to A at 120075205 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090071]
AlphaFold Q50L42
Predicted Effect probably benign
Transcript: ENSMUST00000090071
SMART Domains Protein: ENSMUSP00000087525
Gene: ENSMUSG00000050211

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
C2 82 182 3.42e-14 SMART
low complexity region 191 207 N/A INTRINSIC
PLAc 311 818 5.17e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155641
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytosolic phospholipase A2 group IV family. Members of this family are involved in regulation of membrane tubule-mediated transport. The enzyme encoded by this member of the family plays a role in trafficking through the clathrin-independent endocytic pathway. The enzyme regulates the recycling process via formation of tubules that transport internalized clathrin-independent cargo proteins back to the cell surface. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TG TGTGGCTGCCG 1: 82,891,310 (GRCm39) probably benign Het
Blm CTCC CTCCTCCTCCTCATCC 7: 80,162,678 (GRCm39) probably benign Het
Cacna1f GAG GAGTAG X: 7,486,296 (GRCm39) probably null Het
Ccdc85c GCC GCCACC 12: 108,240,871 (GRCm39) probably benign Het
Chga AGC AGCGGC 12: 102,527,655 (GRCm39) probably benign Het
Crtam TTCTTGATCTGAA T 9: 40,895,650 (GRCm39) probably null Het
Dspp TGACAGCAGCGACAGCAG TGACAGCAGCGACAGCAGAGACAGCAGCGACAGCAG 5: 104,326,290 (GRCm39) probably benign Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,602,079 (GRCm39) probably benign Het
F830016B08Rik AAAAAA AAAAAAAAA 18: 60,433,010 (GRCm39) probably benign Het
Gab3 TCT TCTCCT X: 74,043,611 (GRCm39) probably benign Het
Gabre CTC CTCCGGATC X: 71,313,667 (GRCm39) probably benign Het
Gykl1 G A 18: 52,827,488 (GRCm39) R232Q probably benign Het
Haus4 AGGGCAGGCCGCTGGCCACACACCTGGGAGGGGGGCAGGCCGCTGGCCACACACCTGGGAGGGGGGCAGGCCGCTGGCCACACACCTGGGAG AGGGCAGGCCGCTGGCCACACACCTGGGAGGGGGGCAGGCCGCTGGCCACACACCTGGGAG 14: 54,781,577 (GRCm39) probably null Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 67,875,927 (GRCm39) probably benign Het
Irag2 TG TGAGCACATCG 6: 145,119,516 (GRCm39) probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,019,852 (GRCm39) probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,532,752 (GRCm39) probably benign Het
Map1a CAGCTCCAGCTCCAGCTCCAGCTCCA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCAAGCTCCAGCTCCAGCTCCAGCTCCA 2: 121,136,774 (GRCm39) probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Morn4 GTGAG GTGAGTCAAGCATTGAG 19: 42,064,553 (GRCm39) probably null Het
Nefh CCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGACTCACCTGGGGACTTGGCCTCACCTGGGGACTTGG 11: 4,891,021 (GRCm39) probably benign Het
Nefh TCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,023 (GRCm39) probably benign Het
Nefh CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA CTTGGCCTCACCTGGGGAATTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA 11: 4,891,016 (GRCm39) probably benign Het
Nolc1 CAGCAGC CAGCAGCAGAAGCAGC 19: 46,069,810 (GRCm39) probably benign Het
Or10n7-ps1 AAAATA AAAATAAATA 9: 39,598,043 (GRCm39) probably null Het
Phc1 TG TGCTGCGG 6: 122,300,559 (GRCm39) probably benign Het
Prr36 TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC 8: 4,266,273 (GRCm39) probably benign Het
Ptdss1 G T 13: 67,093,412 (GRCm39) S84I possibly damaging Het
Ren1 ACCGC AC 1: 133,278,519 (GRCm39) probably benign Het
Rinl G T 7: 28,496,988 (GRCm39) G496V probably damaging Het
Ryr3 CTGA C 2: 112,740,869 (GRCm39) probably benign Het
Sbp A AAAAAGATGATGACAC 17: 24,164,340 (GRCm39) probably benign Het
Slc39a4 GTC GTCATCATGATCACCATGGTCACCATGATCACTGTGTTC 15: 76,499,070 (GRCm39) probably benign Het
Spaca1 TCTCGC TCTCGCGCTCGC 4: 34,049,846 (GRCm39) probably benign Het
Spaca1 TCGC TCGCTCGCGC 4: 34,049,854 (GRCm39) probably benign Het
Spmap2l ATCCTCCCCAGTCCCGCAAGGCCAG ATCCTCCCCAGTCCCGCAAGGCCAGCGCTCCTCCCCAGTCCCGCAAGGCCAG 5: 77,164,252 (GRCm39) probably benign Het
Strn C CCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTA 17: 78,984,717 (GRCm39) probably null Het
Tmem59 T TGTTTGTTG 4: 107,047,729 (GRCm39) probably benign Het
Tob1 GCA GCAACA 11: 94,105,287 (GRCm39) probably benign Het
Zfp683 TGTGG TGTGGTGG 4: 133,786,185 (GRCm39) probably benign Het
Other mutations in Pla2g4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Pla2g4e APN 2 120,015,719 (GRCm39) missense probably benign
IGL01712:Pla2g4e APN 2 120,019,884 (GRCm39) critical splice donor site probably null
IGL01859:Pla2g4e APN 2 120,013,214 (GRCm39) missense possibly damaging 0.70
IGL02334:Pla2g4e APN 2 120,017,717 (GRCm39) missense probably benign
FR4737:Pla2g4e UTSW 2 120,075,205 (GRCm39) small deletion probably benign
R0157:Pla2g4e UTSW 2 120,000,662 (GRCm39) missense probably benign 0.00
R0578:Pla2g4e UTSW 2 120,075,162 (GRCm39) splice site probably benign
R0675:Pla2g4e UTSW 2 120,030,679 (GRCm39) splice site probably benign
R1278:Pla2g4e UTSW 2 119,998,951 (GRCm39) critical splice donor site probably null
R1346:Pla2g4e UTSW 2 120,013,253 (GRCm39) missense probably damaging 1.00
R1760:Pla2g4e UTSW 2 120,000,527 (GRCm39) missense possibly damaging 0.50
R1773:Pla2g4e UTSW 2 120,075,202 (GRCm39) missense probably benign
R1792:Pla2g4e UTSW 2 119,998,955 (GRCm39) missense probably damaging 1.00
R2129:Pla2g4e UTSW 2 120,013,292 (GRCm39) missense probably damaging 0.99
R2160:Pla2g4e UTSW 2 120,015,687 (GRCm39) missense probably benign 0.00
R2191:Pla2g4e UTSW 2 120,021,680 (GRCm39) frame shift probably null
R3901:Pla2g4e UTSW 2 119,999,085 (GRCm39) missense probably benign 0.00
R4342:Pla2g4e UTSW 2 120,016,927 (GRCm39) intron probably benign
R4414:Pla2g4e UTSW 2 120,013,194 (GRCm39) missense probably benign
R4460:Pla2g4e UTSW 2 120,016,863 (GRCm39) missense possibly damaging 0.53
R4581:Pla2g4e UTSW 2 120,016,863 (GRCm39) missense possibly damaging 0.53
R4599:Pla2g4e UTSW 2 120,016,863 (GRCm39) missense possibly damaging 0.53
R4601:Pla2g4e UTSW 2 120,016,863 (GRCm39) missense possibly damaging 0.53
R4610:Pla2g4e UTSW 2 120,016,863 (GRCm39) missense possibly damaging 0.53
R4611:Pla2g4e UTSW 2 120,016,863 (GRCm39) missense possibly damaging 0.53
R4664:Pla2g4e UTSW 2 120,001,669 (GRCm39) missense probably damaging 0.97
R4688:Pla2g4e UTSW 2 119,998,414 (GRCm39) missense possibly damaging 0.82
R4691:Pla2g4e UTSW 2 120,004,781 (GRCm39) missense probably damaging 1.00
R4944:Pla2g4e UTSW 2 120,001,718 (GRCm39) missense probably benign 0.01
R5051:Pla2g4e UTSW 2 120,004,785 (GRCm39) missense probably damaging 1.00
R5285:Pla2g4e UTSW 2 120,019,985 (GRCm39) missense probably damaging 1.00
R5373:Pla2g4e UTSW 2 120,016,876 (GRCm39) missense probably benign 0.30
R5374:Pla2g4e UTSW 2 120,016,876 (GRCm39) missense probably benign 0.30
R5505:Pla2g4e UTSW 2 120,075,256 (GRCm39) missense probably benign 0.08
R5702:Pla2g4e UTSW 2 120,018,992 (GRCm39) missense possibly damaging 0.61
R6300:Pla2g4e UTSW 2 120,013,219 (GRCm39) missense probably benign 0.00
R6711:Pla2g4e UTSW 2 120,001,751 (GRCm39) missense probably benign 0.00
R6920:Pla2g4e UTSW 2 120,015,795 (GRCm39) missense possibly damaging 0.82
R6961:Pla2g4e UTSW 2 120,004,851 (GRCm39) splice site probably null
R6987:Pla2g4e UTSW 2 120,016,861 (GRCm39) missense probably benign 0.01
R7028:Pla2g4e UTSW 2 120,000,676 (GRCm39) missense probably damaging 1.00
R7138:Pla2g4e UTSW 2 120,001,759 (GRCm39) missense probably damaging 1.00
R7300:Pla2g4e UTSW 2 120,021,680 (GRCm39) missense probably damaging 1.00
R7355:Pla2g4e UTSW 2 120,011,982 (GRCm39) missense possibly damaging 0.91
R7502:Pla2g4e UTSW 2 120,004,819 (GRCm39) splice site probably null
R7849:Pla2g4e UTSW 2 120,015,803 (GRCm39) missense probably benign 0.32
R8288:Pla2g4e UTSW 2 120,018,990 (GRCm39) critical splice donor site probably null
R8686:Pla2g4e UTSW 2 120,075,172 (GRCm39) missense probably damaging 0.98
R9003:Pla2g4e UTSW 2 120,007,282 (GRCm39) missense probably benign 0.03
R9023:Pla2g4e UTSW 2 120,001,718 (GRCm39) missense probably benign 0.01
R9261:Pla2g4e UTSW 2 120,019,910 (GRCm39) missense probably benign 0.04
R9284:Pla2g4e UTSW 2 120,004,730 (GRCm39) splice site probably benign
R9299:Pla2g4e UTSW 2 120,002,204 (GRCm39) missense probably damaging 1.00
R9338:Pla2g4e UTSW 2 120,019,914 (GRCm39) missense probably benign 0.07
R9555:Pla2g4e UTSW 2 120,075,400 (GRCm39) start gained probably benign
R9604:Pla2g4e UTSW 2 120,015,680 (GRCm39) missense probably benign 0.02
Z1177:Pla2g4e UTSW 2 120,012,004 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTGGTTTTCTGAACACAAAGAGG -3'
(R):5'- ACACTCCGATGAAGCAGACG -3'

Sequencing Primer
(F):5'- TTTCTGAACACAAAGAGGTAAAGAC -3'
(R):5'- CAGACGTGGCTGGGATGAC -3'
Posted On 2019-12-04