Incidental Mutation 'RF044:Spaca1'
ID 604951
Institutional Source Beutler Lab
Gene Symbol Spaca1
Ensembl Gene ENSMUSG00000028264
Gene Name sperm acrosome associated 1
Synonyms 1700124L11Rik, 4930540L03Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF044 (G1)
Quality Score 214.485
Status Not validated
Chromosome 4
Chromosomal Location 34024872-34050067 bp(-) (GRCm39)
Type of Mutation small insertion (2 aa in frame mutation)
DNA Base Change (assembly) TCGC to TCGCTCGCGC at 34049854 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029927] [ENSMUST00000084734]
AlphaFold Q9DA48
Predicted Effect probably benign
Transcript: ENSMUST00000029927
SMART Domains Protein: ENSMUSP00000029927
Gene: ENSMUSG00000028264

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 79 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084734
SMART Domains Protein: ENSMUSP00000081785
Gene: ENSMUSG00000028264

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 79 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from infertile males. Furthermore, antibodies generated against the recombinant protein block in vitro fertilization. This protein localizes to the acrosomal membrane of spermatids and mature spermatozoa where it is thought to play a role in acrosomal morphogenesis and in sperm-egg binding and fusion, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice are infertile and display globozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TG TGTGGCTGCCG 1: 82,891,310 (GRCm39) probably benign Het
Blm CTCC CTCCTCCTCCTCATCC 7: 80,162,678 (GRCm39) probably benign Het
Cacna1f GAG GAGTAG X: 7,486,296 (GRCm39) probably null Het
Ccdc85c GCC GCCACC 12: 108,240,871 (GRCm39) probably benign Het
Chga AGC AGCGGC 12: 102,527,655 (GRCm39) probably benign Het
Crtam TTCTTGATCTGAA T 9: 40,895,650 (GRCm39) probably null Het
Dspp TGACAGCAGCGACAGCAG TGACAGCAGCGACAGCAGAGACAGCAGCGACAGCAG 5: 104,326,290 (GRCm39) probably benign Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,602,079 (GRCm39) probably benign Het
F830016B08Rik AAAAAA AAAAAAAAA 18: 60,433,010 (GRCm39) probably benign Het
Gab3 TCT TCTCCT X: 74,043,611 (GRCm39) probably benign Het
Gabre CTC CTCCGGATC X: 71,313,667 (GRCm39) probably benign Het
Gykl1 G A 18: 52,827,488 (GRCm39) R232Q probably benign Het
Haus4 AGGGCAGGCCGCTGGCCACACACCTGGGAGGGGGGCAGGCCGCTGGCCACACACCTGGGAGGGGGGCAGGCCGCTGGCCACACACCTGGGAG AGGGCAGGCCGCTGGCCACACACCTGGGAGGGGGGCAGGCCGCTGGCCACACACCTGGGAG 14: 54,781,577 (GRCm39) probably null Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 67,875,927 (GRCm39) probably benign Het
Irag2 TG TGAGCACATCG 6: 145,119,516 (GRCm39) probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,019,852 (GRCm39) probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,532,752 (GRCm39) probably benign Het
Map1a CAGCTCCAGCTCCAGCTCCAGCTCCA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCAAGCTCCAGCTCCAGCTCCAGCTCCA 2: 121,136,774 (GRCm39) probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Morn4 GTGAG GTGAGTCAAGCATTGAG 19: 42,064,553 (GRCm39) probably null Het
Nefh CCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGACTCACCTGGGGACTTGGCCTCACCTGGGGACTTGG 11: 4,891,021 (GRCm39) probably benign Het
Nefh CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA CTTGGCCTCACCTGGGGAATTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA 11: 4,891,016 (GRCm39) probably benign Het
Nefh TCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,023 (GRCm39) probably benign Het
Nolc1 CAGCAGC CAGCAGCAGAAGCAGC 19: 46,069,810 (GRCm39) probably benign Het
Or10n7-ps1 AAAATA AAAATAAATA 9: 39,598,043 (GRCm39) probably null Het
Phc1 TG TGCTGCGG 6: 122,300,559 (GRCm39) probably benign Het
Pla2g4e AGGG A 2: 120,075,205 (GRCm39) probably benign Het
Prr36 TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC 8: 4,266,273 (GRCm39) probably benign Het
Ptdss1 G T 13: 67,093,412 (GRCm39) S84I possibly damaging Het
Ren1 ACCGC AC 1: 133,278,519 (GRCm39) probably benign Het
Rinl G T 7: 28,496,988 (GRCm39) G496V probably damaging Het
Ryr3 CTGA C 2: 112,740,869 (GRCm39) probably benign Het
Sbp A AAAAAGATGATGACAC 17: 24,164,340 (GRCm39) probably benign Het
Slc39a4 GTC GTCATCATGATCACCATGGTCACCATGATCACTGTGTTC 15: 76,499,070 (GRCm39) probably benign Het
Spmap2l ATCCTCCCCAGTCCCGCAAGGCCAG ATCCTCCCCAGTCCCGCAAGGCCAGCGCTCCTCCCCAGTCCCGCAAGGCCAG 5: 77,164,252 (GRCm39) probably benign Het
Strn C CCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTA 17: 78,984,717 (GRCm39) probably null Het
Tmem59 T TGTTTGTTG 4: 107,047,729 (GRCm39) probably benign Het
Tob1 GCA GCAACA 11: 94,105,287 (GRCm39) probably benign Het
Zfp683 TGTGG TGTGGTGG 4: 133,786,185 (GRCm39) probably benign Het
Other mutations in Spaca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Spaca1 APN 4 34,029,077 (GRCm39) missense probably damaging 0.99
IGL01871:Spaca1 APN 4 34,040,894 (GRCm39) missense probably damaging 0.98
F5770:Spaca1 UTSW 4 34,039,311 (GRCm39) missense probably damaging 0.99
FR4342:Spaca1 UTSW 4 34,049,838 (GRCm39) small insertion probably benign
FR4548:Spaca1 UTSW 4 34,049,856 (GRCm39) small insertion probably benign
FR4737:Spaca1 UTSW 4 34,049,836 (GRCm39) small insertion probably benign
FR4976:Spaca1 UTSW 4 34,049,849 (GRCm39) small insertion probably benign
FR4976:Spaca1 UTSW 4 34,049,844 (GRCm39) small insertion probably benign
R0377:Spaca1 UTSW 4 34,044,267 (GRCm39) splice site probably null
R1861:Spaca1 UTSW 4 34,044,206 (GRCm39) missense probably damaging 0.99
R3105:Spaca1 UTSW 4 34,028,468 (GRCm39) missense probably damaging 1.00
R4930:Spaca1 UTSW 4 34,044,236 (GRCm39) missense possibly damaging 0.65
R5030:Spaca1 UTSW 4 34,039,247 (GRCm39) missense possibly damaging 0.65
R5137:Spaca1 UTSW 4 34,029,095 (GRCm39) missense probably damaging 1.00
R5264:Spaca1 UTSW 4 34,049,863 (GRCm39) missense possibly damaging 0.53
R6158:Spaca1 UTSW 4 34,029,176 (GRCm39) missense probably damaging 0.99
R6824:Spaca1 UTSW 4 34,049,869 (GRCm39) missense probably benign 0.00
R8039:Spaca1 UTSW 4 34,044,207 (GRCm39) missense probably damaging 0.99
R8094:Spaca1 UTSW 4 34,049,837 (GRCm39) missense possibly damaging 0.55
R8134:Spaca1 UTSW 4 34,042,157 (GRCm39) splice site probably null
R9120:Spaca1 UTSW 4 34,029,168 (GRCm39) missense probably damaging 0.97
RF006:Spaca1 UTSW 4 34,049,853 (GRCm39) small insertion probably benign
RF017:Spaca1 UTSW 4 34,049,853 (GRCm39) small insertion probably benign
RF032:Spaca1 UTSW 4 34,049,854 (GRCm39) small insertion probably benign
RF043:Spaca1 UTSW 4 34,049,846 (GRCm39) small insertion probably benign
RF044:Spaca1 UTSW 4 34,049,846 (GRCm39) small insertion probably benign
RF060:Spaca1 UTSW 4 34,049,841 (GRCm39) small insertion probably benign
V7580:Spaca1 UTSW 4 34,039,311 (GRCm39) missense probably damaging 0.99
V7581:Spaca1 UTSW 4 34,039,311 (GRCm39) missense probably damaging 0.99
V7582:Spaca1 UTSW 4 34,039,311 (GRCm39) missense probably damaging 0.99
V7583:Spaca1 UTSW 4 34,039,311 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCAGAAAACTCTACAGAAGATGG -3'
(R):5'- TTCTGGCCACTGTTCGAAGC -3'

Sequencing Primer
(F):5'- TCTACAAAAGGATGGGCTT -3'
(R):5'- ACTGTTCGAAGCAGCCTC -3'
Posted On 2019-12-04